Labshake search
Citations for Agilent :
501 - 550 of 1057 citations for S 3 Amino 4 4 cyanophenyl butanoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Silica beads functionalized with phenyl-boronic acid (Bondesil-PBA 40µm, Agilent) were used for glycopeptides enrichment at an optimized ratio of 1:2.5 sample:PBA beads w/w ...
-
bioRxiv - Immunology 2024Quote: Extracellular acid ratio was determined by Seahorse Flux Analyzer XF96 (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The long chain fatty acid oxidation stress test (Agilent, 103672-100) was performed to measure oxygen consumption rates (OCR ...
-
bioRxiv - Immunology 2020Quote: ... The RBD domain of SARS-CoV-2 S was biotinylated and tetramerized with streptavidin-APC (Agilent). The APC decoy reagent was generated by conjugating SA-APC to Dylight 755 using a DyLight 755 antibody labeling kit (ThermoFisher) ...
-
bioRxiv - Zoology 2021Quote: ... diluted with anti-S100 rabbit serum solution (Envision FLEX-S-100, Agilent Technologies, Santa Clara, CA) that was used in zebrafish crypt OSNs as validated in Germanà et al ...
-
bioRxiv - Bioengineering 2022Quote: ... using a PLRP-S column (2.1 x 150 mm, 300Å, 3µm) (Agilent Technologies, Santa Clara, CA) as described previously11.
-
bioRxiv - Biochemistry 2023Quote: ... through integration of extracted ion chromatograms (EIC) corresponding to products (P) and substrates (S) (Agilent ChemStation) and normalized according to equation: Multiple products were observed for Axl substrates Syn A ...
-
bioRxiv - Cancer Biology 2024Quote: ... at 1:50 dilution for 30 min and anti-Ki67 antibody (M7240, Dako Denmark A/S) at 1:100 dilution for 20 min ...
-
bioRxiv - Cell Biology 2024Quote: ... and UV-crosslinked at 120,000 µJ/cm2 for 150 s using a UV Stratalinker 2400 (Stratagene). For immunoblotting ...
-
bioRxiv - Biochemistry 2024Quote: ... with in-house packed with PLRP-S trap (25 mm length by 150 µm i.d., Agilent). The total run time was 120 min using a gradient of mobile phase A (99.9% water ...
-
bioRxiv - Plant Biology 2023Quote: ... Lipid bands were scratched from the plates and their fatty acids extracted (fatty acid methyl esters FAMEs) and quantified by GC-MS (Agilent 7890 A and MSD 5975 Agilent EI) as in (39) ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
Machine learning and data-driven inverse modeling of metabolomics unveil key process of active agingbioRxiv - Systems Biology 2024Quote: ... Gas separation was performed on the HP-5MS column (30 m 3 0.25 mm 3 0.25 mm, Agilent Technologies).
-
bioRxiv - Developmental Biology 2021Quote: ... Cultures were blocked for 45 min with blocking buffer (BB) containing 6%Goat serum (Dako, S-100) in DPBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Analytes were separated on an Agilent PLRP-S column (5 μm; 2.1 × 50 mm, 1000Å Agilent Technologies) at 60 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... 600 ng of total protein was injected onto a home-packed PLRP column (PLRP-S) (Agilent Technologies), 10-µm particle size ...
-
bioRxiv - Cell Biology 2023Quote: ... metabolic labelling was performed in BOEC protein extracts using ENG mAb SN6h (Dako Denmark A/S, Denmark). Modifying methods of Pece et al,18 a 1 hour “pulse” with 50μCi/ml of 35S methionine ...
-
bioRxiv - Biophysics 2023Quote: ... USA) and a reversed-phase analytical column (PLRP-S for Biomolecules, Agilent Technologies, Santa Clara, CA, USA). Peptide digestion was carried out online at a flow rate of 75 μl/min (0.4 % formic acid in water ...
-
bioRxiv - Plant Biology 2020Quote: The contents of celastrol and wilforic acid A were analyzed by Agilent 1260LC-6400 QQQ (triple quadrupole mass) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using a telomere PNA (peptide nucleic acid) FISH Kit/FITC (DAKO, Denmark) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The Long-Chain Fatty Acid Substrate Oxidation kit (Agilent cat #103672-100) was utilized to probe differences in OCR upon injection with either vehicle (media only ...
-
bioRxiv - Cancer Biology 2022Quote: ... The matrix employed was α-cyanohydroxycinnamic acid obtained in solution from Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... Resin acid identification and quantification were performed by capillary GC (Agilent 7890A). Helium ...
-
bioRxiv - Microbiology 2024Quote: ... Fatty acids were identified with a mass spectrometer (Agilent 5977B GC/MSD) according to the comparison of retention times of commercial fatty acid standards (Supelco 37) ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Cell Biology 2020Quote: ... The immune complexes were visualized with anti-rabbit or anti-mouse HPR-conjugated secondary antibodies (DAKO A/S) and enhanced by Clarity Western ECL Substrate (BioRad ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a HPLC column (PLRP-S 1000 Å, 5 mm, 50×2.1 mm, Agilent Technologies, Santa Clara, CA). The following solvents were used ...
-
bioRxiv - Biochemistry 2024Quote: ... 17 500 ng of total protein was injected onto a home-packed PLRP column (PLRP-S) (Agilent Technologies), 10 μm particle size ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the concentration of various organic acids were measured by HPLC (Agilent, 1260 Infinity), using a standard analytical system (Shimadzu ...
-
bioRxiv - Physiology 2022Quote: Free fatty acid composition was evaluated by GC-MS (Agilent technology GC7890-MS5975). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... fatty acid oxidation was assessed by using the Seahorse XF24 Analyzer (Agilent Technologies) to measure mitochondrial respiration ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the fatty acids were dosed from the autosampler of a GC (Agilent 7890A) as pulses to the front inlet packed with the catalyst bed (maintained in the range 250-400 °C) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Library quality was confirmed using the Agilent 2200 TapeStation Nucleic Acids System (Agilent).
-
bioRxiv - Molecular Biology 2022Quote: ... and 2.5 µM medronic acid (5191-4506, Agilent Technologies, Santa Clara, CA, USA). The LC gradient was ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The quality of nucleic acids was assessed with a Fragment Analyzer (Agilent, Switzerland) at the Lausanne Genomic Technologies Facility of the University of Lausanne.
-
bioRxiv - Cell Biology 2020Quote: ... The desalted large peptide mixture was separated by a home-packed PLRP column (PLRP-S, 200 mm length x 500 μm i.d., 10 μm particle size, 1,000 Å pore size, Agilent) in a 63-min gradient from 10% to 90% mobile phase B (mobile phase A ...
-
bioRxiv - Bioengineering 2020Quote: ... VO2max = 1.04×10−16 mol/s/cell was measured for hiPSC-Heps using the Seahorse XF24 cellular respirometer (Agilent) (see ...
-
bioRxiv - Molecular Biology 2021Quote: ... About 1.0 µg of protein for each sample was injected, bound to a PLRP-S column (2.1mm x 50mm, 5μm, 300Å) (Agilent Technologies), desalted ...