Labshake search
Citations for Agilent :
601 - 650 of 776 citations for 3 Chloro phenyl 9H fluoren 9 ylmethoxycarbonylamino acetic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... RNA concentration was measured by Nanodrop and 1 to 3 μg of RNA was reverse transcribed with AffinityScript Multi-Temp RT (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed 3 times 10 min in Tris-Triton Solution and mounted on gelatin-coated slides using Fluorescence Mounting Medium (Dako). Z-stack images (4 optical sections ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: ... The purified PCR products were subsequently used as megaprimers to generate the library of mutants in the plasmid pZE-ProQ-3×FLAG by following GeneMorph II EZClone Domain Mutagenesis Kit (Agilent) guidelines ...
-
bioRxiv - Microbiology 2020Quote: ... was generated by introducing mutations in the 3’ splice site of the pPOLI-WSN-M plasmid using QuikChange II site-directed mutagenesis protocol (Agilent). pPolI-WSN-M-M2SMRtoAAA (Mut1) ...
-
bioRxiv - Microbiology 2020Quote: ... an optimal mutation rate (0.3–1 base/kb) for 1µg of template was adopted as recommended in GeneMorph II Random Mutagenesis kit (Agilent Technologies). The PCR products were then digested with EcoRI and HindIII and ligated into the pJF118EH vector using the same restriction enzymes ...
-
bioRxiv - Physiology 2021Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Plant Biology 2021Quote: ... and 3 μl were injected in a splitless mode into an Agilent Gas chromatography mass spectrometry (GC-MS) system (Agilent 7890A chromatograph ...
-
bioRxiv - Plant Biology 2021Quote: ... The Zorbax Eclipse Plus C-18 column Rapid Resolution HT (3 X 100 mm, 1.8 μm, 600 bar, Agilent, USA) was kept at 25°C and the elution was performed with acetonitrile (Optima ...
-
bioRxiv - Molecular Biology 2020Quote: ... The free HSF2BP protein as well as the complex between ARM and F15X were analyzed using a Bio SEC-3 column (Agilent) equilibrated in 25 mM Tris-HCl buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Bisulfite-converted DNA was used for PCR amplification of the DMRs and products were visualized on a 3% Tris-Acetate-EDTA agarose gel and quantified by TapeStation (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... A Ddyo7-mCherry expression plasmid was generated by first TA cloning a PCR product (myo42 to myi185+2) encompassing the myoi 3’ region of the gene (aa 475 - end) minus the stop codon using StrataClone (Agilent) (pDTi289+2) ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Immunology 2021Quote: ... 3×105 CD8+ T cells were plated onto poly-D-lysine coated wells and assayed in XF RPMI medium (Agilent) pH 7.4 supplemented with 10 mM glucose and 2 mM glutamine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were subjected to antigen retrieval antigen retrieval (pH = 6.0 for cleaved caspase-3 and pH = 9.0 for cleaved PARP-1) followed by washing with PBS and incubation in hydrogen peroxide (Dako, #S2003) to inhibit endogenous peroxidase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were then washed for 3 min in TBST and incubated for 30 min with HRP (Horse Raddish Peroxidase) conjugated anti-rabbit (Ref: K4003, Dako) or anti-mouse (Ref ...
-
bioRxiv - Biochemistry 2022Quote: UPLC separations were performed on a reverse phase Poroshell 120 EC-C18 column (3 × 100 mm, 2.7 μm) (Agilent Technologies) operating at 30 °C and a flow rate of 0.4 mL/min ...
-
bioRxiv - Cancer Biology 2022Quote: ... For signal detection the MACH 3 Mouse HRP Polymer Detection system was employed according to manufacturer’s protocol using DAB+ (Fa.Agilent Technologies, K3468). Slides were counter-stained with Hematoxylin Gill’s Formula (Fa.Vector ...
-
bioRxiv - Microbiology 2022Quote: All of the indicated mutations were introduced into a plasmid backbone expressing His6 tagged pNL4-3-derived IN by QuikChange site directed mutagenesis kit (Agilent) (66) ...
-
bioRxiv - Neuroscience 2020Quote: ... DI rinse and wash buffer prior to a 3-minute incubation with Haematoxylin ready-to-use solution (K8018, Agilent DAKO) and a further DI rinse and wash step ...
-
bioRxiv - Neuroscience 2020Quote: ... DI rinse and wash buffer prior to a 3-minute incubation with Haematoxylin ready-to-use solution (K8018, Agilent DAKO) and a further DI rinse and wash step ...
-
bioRxiv - Neuroscience 2021Quote: RNA-seq libraries were prepared for each time-points and seady-state sample using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen) automated on the NGS WorkStation (Agilent) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Cancer Biology 2021Quote: ... slides were de-waxed and antigen retrieval was performed in a pressure cooker at 125°C for 3 min employing an Antigen Retrieval solution (Dako, pH6 for EZH2 ...
-
bioRxiv - Microbiology 2022Quote: ... 50 mg/mL glycogen (1/50 vol/vol and 3 volumes of 100% ethanol. The quality of the isolated RNA was assessed on an Agilent Bioanalyzer ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Peptides were trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) before being separated on an analytical column (Agilent Poroshell EC-C18 ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into pVp16-Dest vector for IPTG (isopropyl-β-thiogalactopyranoside)-induced expression (3 h at 37°C) in E.coli strain ArcticExpress (Agilent). After sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then all membranes were washed 3 times and mounted on coverslips using an aqueous fluorescent mounting medium (DakoCytomation, Huddinge, Sweden). Samples were analysed with Leica TCS SP8 confocal microscope (Leica Microsystems ...
-
bioRxiv - Neuroscience 2021Quote: ... free floating sections were blocked with 3% donkey serum and incubated overnight with either rabbit anti-GFAP (1:10000, Dako), rat anti-CD68 (1:200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... SPEC-PTSCX sample cleanup pipette tips and Bond Elut C18/ 3 mL cleanup cartridges were from Agilent (Santa Clara, CA), cell culture slides (8-chamber ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 PCR reactions including two biological replicates and 3 technical replicates per gene were performed using Brilliant SYBR master mix (Agilent), running cycles of 10 minutes at 95°C ...
-
bioRxiv - Molecular Biology 2021Quote: Primary brown adipose cells were isolated and cultured for 3 days before plated in XF cell culture microplates (Seahorse Bioscience). Cells (10,000 cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were trapped (Dr. Maisch Reprosil C18, 3 µm, 2 cm x 100 µm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
bioRxiv - Genetics 2020Quote: Single variants were introduced by mutagenesis of the Tile 3-KCNH2 plasmid (Table S1) using the Quikchange Lightning Multi kit (Agilent), with 1 primer per variant ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in FACS staining buffer (3% FBS in PBS) and analyzed by flow cytometry on a Novocyte 3000 (Agilent). Flow cytometry results were analyzed using NovoExpress (version 1.5.6).
-
bioRxiv - Microbiology 2023Quote: ... solution and 3 μl of each sample were subjected to high-resolution liquid chromatography-mass spectrometry (LC-MS) analysis (Agilent iFunnel 6550 quadrupole time-of-flight (QTOF) ...
-
bioRxiv - Microbiology 2023Quote: ... along with gene-specific primers listed in Supplemental Table 3 and qPCR was performed in technical triplicate on a StepOnePlus (Stratagene). Ct values of target genes were normalized to β-actin and relative gene expression levels between conditions were calculated via the ΔΔCt method ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... of HIV-1 were amplified by PCR using KOD-Plus-Neo and pNL4-3 as a template and cloned into pBluescript II KS(-) (212208, Agilent). The MLV 5’-LTR (1 - 207 nt ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HLA-I affinity chromatography was performed using a 96-well single-use micro-plate with 3 μm glass fiber and 10 μm polypropylene membranes (Agilent). Sep-Pak tC18 100 mg Sorbent 96-well plates (Waters ...
-
bioRxiv - Microbiology 2022Quote: ... and tRNA was isolated to purity from the small RNA fraction following HPLC on the Bio SEC-3 column (Agilent; 7.8 mm ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .