Labshake search
Citations for Agilent :
6001 - 6050 of 7968 citations for Mouse Antigen peptide transporter 2 TAP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... and its integrity was assessed using RNA 6000 Nano LabChip Kit in microcapillary electrophoresis (Agilent 2100 Bioanalyzer, Agilent Technologies). Samples were then stored at −80°C until sequencing.
-
bioRxiv - Genomics 2022Quote: ... RT was performed with a specific primer (5′-CCTACACGACGCTCTTCC-3′) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). RNA degradation was performed by incubating the RT mixture with 10% 1 M NaOH (2μl of RT mixture ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site directed mutagenesis was performed following the manufacturer’s protocol using the Quick-Change II site-directed mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Biophysics 2022Quote: Site-directed mutagenesis of the human yb-1 coding gene was carried out directly on the pET22b-YB-1_1-180 expression plasmid by using the “Quikchange II XL site-directed mutagenesis kit” from Stratagene and appropriate oligonucleotides (Eurofins Genomics) ...
-
bioRxiv - Biophysics 2022Quote: ... G553I) variant were cloned using the QuikChange II Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Agilent Technologies, #200523). All plasmids were sequenced to confirm the correct sequences (Genewiz).
-
bioRxiv - Developmental Biology 2022Quote: ... The quality of ATAC libraries was assessed with Agilent Bioanalyzer with DNA High Sensitivity kit (Agilent Technologies, 5067-4627) and quantified with Kapa NGS library quantification kit (Kapa Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... The quality of cDNA traces was checked using a High Sensitivity DNA Kit in a Bioanalyzer instrument (Agilent Technologies).
-
bioRxiv - Neuroscience 2020Quote: ... Cy3 labeling was performed with T7 RNA polymerase using Agilent Low RNA Input Linear Amplification Kit following manufacturer’s instructions (Agilent). The microarray was performed using the SuperPrint G3 Mouse GE 8×60K Microarray Kit (Agilent ...
-
bioRxiv - Microbiology 2020Quote: ... The final length and concentration of the amplicons were confirmed using a Bioanalyzer DNA 1000 Kit (Agilent Technologies, USA). The library was subsequently diluted to 50 pM and loaded into the Ion 318 chip using an Ion Chef Instruments with an Ion PGM Hi-Q Chef Solutions ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA integrity was confirmed using the RNA Nano 6000 assay kit of the Bioanalyzer 2100 system (Agilent Technologies, USA). Poly(A ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and quality checked on a Bioanalyzer High Sensitivity Chip on an Agilent Bioanalyzer 2100 (Kit #5067-4626, Agilent Technologies). The library was sequenced on two lanes of a Illumina HiSeq 3000 system in paired end mode and 150bp read length.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and quality checked on a Bioanalyzer High Sensitivity Chip on an Agilent Bioanalyzer 2100 (Kit #5067-4626, Agilent Technologies). A detailed hands-on protocol can be found here ...
-
bioRxiv - Developmental Biology 2020Quote: ... Final libraries were quantified and checked for fragment size distribution using a Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies). Pooled sequencing of Nextera libraries was carried out using a HiSeq4000 (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Insert size and concentration of each pooled library were determined using an Agilent Bioanalyzer DNA 1000 kit (Agilent Technologies). Paired-end (2×150bp ...
-
bioRxiv - Microbiology 2020Quote: ... Insert sizes and concentrations of each pooled library were determined using an Agilent Bioanalyzer DNA 1000 kit (Agilent Technologies). Paired-end sequencing (2×150-bp reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... The digested samples were also qualified on Agilent 2100 Bioanalyzer using High Sensitivity DNA Kit (Agilent Technologies, 5067-4626). The condition giving approximately 65% mono- ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation variants found in P.1 and 10-mutation variant (BZΔ10) were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana VSV (rVSV ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA library quality was quantified by a 2100 Bioanalyzer using an Agilent high-sensitivity DNA kit (Agilent, 5067-4626). Libraries were sequenced separately as 75-bp single ends on an Illumina NextSeq 500.
-
bioRxiv - Neuroscience 2021Quote: ... which were assessed by the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Sequencing libraries were prepared using the NEB Next Ultra RNA Library Prep Kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: Mitochondrial respiration in live MSCs were measured using seahorse XF24 Extracellular Flux Analyzer with Mito stress test kit according to manufacturer’s protocol (Agilent). In brief ...
-
bioRxiv - Microbiology 2020Quote: Electrophoretic analyses were performed on the TapeStation 4500 (D1000 Screen Tape and D1000 Reagents kits; all from Agilent Technologies) or by horizontal electrophoresis using a 2% (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fragment size of the final libraries was determined using the Bioanalyzer High-Sensitivity DNA Kit (Agilent, CA, USA). Their concentration was determined using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... were introduced into the BG505 SOSIP.v5.2 pPPI4 vector 53 using the QuikChange® Lightning Site-Directed Mutagenesis kit (Agilent). The R500A and Q658K mutations were added to the BG505 SOSIP.v5.2.N241.N289 vector ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA integrity was assessed using Agilent’s Eukaryotic Total RNA 6000 Nano Kit on an Agilent 2100 BioAnalyzer (Agilent Technologies), and the concentration was subsequently measured using the Qubit RNA HS assay (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA quality was assessed using 2100 Bioanalyzer G2938C using an Agilent RNA 6000 Nano Kit (Agilent; Cat # 5067-1511) and Qubit 4 Fluorometer (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... in one individual by the Hospital for Sick Children (Toronto, Canada) using the Agilent SureSelect Focused Exome Kit (Agilent); in one individual at Hôpital de la Pitié Salpêtrière (Paris ...
-
bioRxiv - Developmental Biology 2022Quote: ... The average length distribution of the fragmented cDNA libraries was assessed by the high sensitivity DNA kit (Agilent, USA) and the libraries quantified by Qubit (Thermo Scientific ...
-
bioRxiv - Genomics 2022Quote: ... while library quality checks were performed using an Agilent 2100 Bioanalyzer and High Sensitivity DNA Kit (Agilent Technologies Ltd.). Individually barcoded RNA-seq libraries were pooled in equimolar quantities and the quantity and quality of the final pooled libraries (two different pools in total ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... All samples were quantified by a Bioanalyzer using the Agilent RNA 6000 Nano Kit reagents and protocol (Agilent Technologies). Only RNA samples with RNA Integrity Number (RIN ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We produced the promoter inserts by performing error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). We used 25 ng of the plasmid construct with the MG1655 lacZ promoter variant cloned into it as a template DNA for the error-prone PCR to achieve approximately 1.5 SNPs per variant sequence ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PKR site-specific mutants and epteK3Δ227-508 were generated by PCR mutagenesis using the QuickChange Lightning mutagenesis kit (Agilent) and primers holding the desired mutations/deletions ...
-
bioRxiv - Genomics 2022Quote: ... Individually indexed IgG and IgM libraries were assessed using the Agilent 2100 Bioanalyzer High Sensitivity DNA Assay Kit (Agilent) and the Qubit 3.0 Fluorometer dsDNA High Sensitivity Assay Kit (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amplified cDNA and final libraries were assessed on an Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies). All the libraries were sequenced on NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amplified cDNA and final libraries were assessed on an Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2019Quote: ... The pBabe-KRAS point mutation Q61H was created by using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) following the recommended protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Pair1 and Rejoin1 mutations were introduced using the site-directed mutagenesis commercial kit QuickChange® II XL (Agilent, CA) according to the manufacture’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... A928V and TYK2-ΔE8 were generated by site-directed mutagenesis using QuickChange XL site-directed mutagenesis kit (Agilent Technologies) in pRc-TYK2 or pQE-His-N [22] ...
-
bioRxiv - Bioengineering 2019Quote: ... RNA integrity was assessed using the RNA Nano 6000 assay kit and the Agilent Bioanalyzer 2100 system (Agilent Technologies).
-
bioRxiv - Plant Biology 2019Quote: ... The Msrab11f1(S29N) mutant was generated using QuikChange II Site-Directed Mutagenesis Kits performed according to the manufacturer’s manual (Stratagene) with the primers CTGGAGTTGGGAAAAACAATCTGCTTTCAAGG ...
-
bioRxiv - Cell Biology 2019Quote: ... Amplified cDNA and final libraries were evaluated on a Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies). Individual libraries were diluted to 4nM and pooled for sequencing ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA quantity and quality was measured using an Agilent 2100 Bioanalyzer with the 6000 Pico Kit (Agilent, 5067-1513).
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis was performed according to the manufacturer’s instructions of QuikChange® Site-Directed Mutagenesis Kit (Agilent Technologies). The reactions were conducted using as template the plasmid pET28a-XfybbN and pET15b-EcYbbN ...
-
bioRxiv - Neuroscience 2019Quote: ... Extracted RNA genomes were converted to complementary DNA using an AccuScript PfuUltra II RT-PCR kit (Agilent Technologies, USA) at 42°C for 2 hours with the following barcoded primer annealing to the rabies virus leader sequence ...
-
bioRxiv - Cancer Biology 2019Quote: ... we undertook massively parallel sequencing using a solution-phase SureSelect hybrid capture kit (Agilent Technologies, Santa Clara, CA, USA) and an HiSeq 2500 sequencer (Illumina) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Real-time quantitative PCR (qPCR) was carried out on a Stratagene Mx3005p with Brilliant III SYBR Green kits (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Methionine153 on pHluorin in pcDNA3.1-pHluorin-CD6320 was mutated to Arginine using QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) with a pair of primers (Forward ...
-
bioRxiv - Immunology 2019Quote: ... MG505.A3 or MG505.H3) was altered by site-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... thermophilus GyrB overexpression 12 was mutated by site directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis kit (Agilent) in order to generate two plasmids harboring K284R or K284Q mutations ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Site-directed mutagenesis of BenM in pMeLS0076 was carried out using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... pME-hB3GALT4-3HA was used as a template and mutagenized by a commercial site-directed mutagenesis kit (Agilent Technologies). UGCG mutant plasmid ...