Labshake search
Citations for Agilent :
551 - 600 of 638 citations for 3 Trifluoromethylthio benzeneboronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Samples were subsequently diluted to adjust the HNO3 concentration to 3 % and ICP-MS was performed with a Hewlett-Packard 4500 ICP mass spectrometer (Agilent Technologies) connected to a CETACASX-500 auto-sampler for sample injection ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Physiology 2023Quote: ... The metabolic function of activated CD4+ T cells cultured for 3 days in vitro was analyzed by measuring the extracellular acidification rate (ECAR) using an XFe96 extracellular flux analyzer (Seahorse Bioscience). The cells were kept in XF media (Seahorse Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance was measured at 562 nanometers using the Bio-Tek Cytation 3 Multi-Mode Reader (Agilent, Santa Clara, CA, USA). The proteins were run on a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Biochemistry 2023Quote: ... (3) RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was cross-linked by exposing the living cells twice to 4,5′,8-trimethylpsoralen at a final concentration of 10 μg/mL followed by 3’ irradiation pulses with UV 365-nm monochromatic light (UV Stratalinker 1800, Agilent Technologies). The cells were then washed repeatedly with cold PBS and lysed with a cell lysis buffer (1.28M sucrose ...
-
bioRxiv - Biophysics 2023Quote: ... The monodisperse sample solutions of proteins were injected onto a size exclusion column (David and Perez 2009) (SEC-3, 150 Å; Agilent) using an Agilent HPLC system and eluted into the capillary cell at a flow rate of 0.3 ml min-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The slides were then treated with 3% hydrogen peroxide for 10 min and then blocked with Serum-Free Protein Block (Dako, X0909) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was quality checked on an Agilent TapeStation System by mixing 3 µL D1000 Sample Buffer (Agilent 5190-6502) with 1 µL pooled library and running in D1000 ScreenTape (Agilent 5067-5582) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Supernatants were loaded into pre-conditioned Phenomenex Strata XL-100 60 mg/3 ml cartridges (Torrance, CA) and passed through it using positive pressure manifold (Agilent Technologies). Flow through was collected subsequently and 100 µL of filtrate was mixed with 100 µL of water for the LC-MS/MS system ...
-
bioRxiv - Microbiology 2024Quote: ... such as the uncut PT oligos and the four 3-mer release oligos (CCA, CCC, CCG, and CCT) using an HPLC system (Agilent 1290) as outlined below ...
-
bioRxiv - Microbiology 2024Quote: ... 100 μL was aliquoted in a 96-well plate in triplicates and the absorbance at 550 nm was measured every 10 s for 3 min using a BioTek Synergy H1 plate reader (Agilent Technologies). Then ...
-
bioRxiv - Plant Biology 2024Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.6 mg mL−1 enzyme with 2 mM nicotine was incubated at 30°C for 3 days before mass spectrometry on 6545 Q-TOF LC/MS system (Agilent, USA) in positive mode ...
-
bioRxiv - Immunology 2024Quote: ... and 2-3 x 105 NK cells per well were seeded in triplicates in Seahorse XF RPMI medium (Agilent, 103576-100) supplemented with 2 mM L-glutamine (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: miR-92b-3p binding sites in each 3’UTR were mutated using the QuikChange II XL site-directed mutagenesis kit (Agilent, #200517) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... primary cultured chondrocytes were seeded at a density of 3 × 104 cells per well into an 8-well Seahorse culture plate (Seahorse Bioscience). For OCR analysis ...
-
Spatiotemporal proteomics reveals the biosynthetic lysosomal membrane protein interactome in neuronsbioRxiv - Cell Biology 2024Quote: ... with solvent A (0.1% formic acid in water) at 30 µl/min flowrate and chromatographically separated over the analytical column (Poroshell 120 EC C18, Agilent Technologies, 50 μm x 75 cm, 2.7 μm) using 180 min gradient at 300 nL/min flow rate ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed in TBST (3 × 15 mins at RT) and then incubated with corresponding peroxidase-conjugated secondary antibodies (Dako, P0447, P0448) for 1h at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... was performed on 3-μm thick tissue sections using split signal FISH DNA probes for BCL2/18q21 (probe Y5407; DAKO A/S), BCL6/3q27 (probe Y5408 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were finally washed for 3 × 10min with PBS before mounting them on glass coverslips with Dako fluorescence conserving media (Dako, Hamburg, Germany).
-
bioRxiv - Cell Biology 2021Quote: ... followed by incubation with 3% hydrogen peroxide to quench endogenous peroxidase activity and 15 minutes in serum-free protein block (DAKO, Glostrup, Denmark). Sections were then subjected to appropriate antigen retrieval methods (if needed ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were incubated overnight at 4° C with primary antibodies (mouse-anti-Ataxin-3, 1:2500, clone 1H9, MAB5360, MerckMillipore, Darmstadt, Germany; rabbit-anti-Ubiquitin, 1:500, Z0458, Dako, Jena, Germany). After washing the membranes were incubated with secondary antibodies (peroxidase affinePure donkey anti-mouse IgG H+L ...
-
bioRxiv - Cancer Biology 2020Quote: To construct RNA-seq libraries from C.elegans samples, we used an automated QuantSeq 3’mRNA-seq (Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... All immunostains were performed in Ventana Discovery (Ki-67 and cleaved caspase 3) or Dako autostainers using 3,3’ diaminobenzidine (DAB) chromogen (Dako-Agilent Technologies, Denmark). All slides were scanned using digital slide scanner NanoZoomer-XR C12000 (Hamamatsu ...
-
bioRxiv - Cell Biology 2020Quote: ... embryos were washed 3 times in PBV and transferred onto a glass microscope slide with DAKO mounting medium (Dako Inc., Carpinteria, California) and enclosed with a coverslip using a spacer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA libraries were assessed for quality and quantification according to the Chromium Single Cell 3’ Reagent kit v3 user guide using the High Sensitivity D5000 ScreenTape (Agilent 5067-5592) and 2200 TapeStation Controller software (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... and antisense primer (5’-GGA GAA AGG CAC CTG CCA GGC CTC AAC-3’) by site-directed mutation according to manufacturer’s protocol (QuikChange II XL Site-Directed Mutagenenesis Kit, 200521; Stratagene, LA Jolla, CA). The primers were designed to delete (in frame ...
-
bioRxiv - Neuroscience 2020Quote: ... the sample quality was checked with both the Qubit 3 Fluorometer and the High Sensitivity D1000 ScreenTape assay (Agilent Technologies #5067-5584). The libraries were equimolarly pooled ...
-
bioRxiv - Cancer Biology 2022Quote: ... slices were then incubated with anti-cleaved caspase 3 antibody or anti-Ki67 antibody (Cell Signalling) and further processed with secondary antibody (LSAB2 horseradish peroxidase kit; Dako, Copenhagen, Denmark).
-
bioRxiv - Biochemistry 2020Quote: ... Thirty-six metabolites were from a list of potential biotransformation products directly derived from HGA and compiled using the Biotransformation Mass Defects application (Agilent; Appendix 3). This tool provides a list of potential metabolic biotransformation products covering both phase I (n=19 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed with Bond Wash buffer 3 x 30s and then incubated with either mouse anti-CD68 (M0814, 1:100, Dako, Carpenteria, CA), mouse anti-βIII-Tubulin (G7121 ...
-
bioRxiv - Cancer Biology 2021Quote: ... endogenous peroxidase activity was blocked by incubation with 3% H2O2 / Methanol for 10 minutes followed by incubation with Dako Dual Endogenous Enzyme Block reagent (Agilent Dako, S2003) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... E706A/E1015A and E437A/E706A/E1015A=EallA) were obtained by site-directed mutagenesis of pCS2-3×HA-NFATc3 using the QuickChange® II XL kit (Agilent Technologies) using the indicated primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... the 3 liver cancer specimens also underwent bulk-level WES using Agilent SureSelect Human All Exon v7 K it (Agilent, 5191-4005) and illumina NovaSeq 2 × 150 bp sequencing mode ...
-
bioRxiv - Systems Biology 2023Quote: ... Membranes were washed 3 times with TBST for 10 min at room temperature and incubated with horseradish peroxidase coupled secondary antibodies (Dako, P0448/P0447) at room temperature for 1 h (1:2000 in 0.3% (w/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cleared lysates were loaded on wells of 96-well single-use filter micro-plates with 3 µm glass fibers and 25 µm polyethylene membranes (Agilent, 204495-100) containing the HB95 cross-linked beads ...
-
bioRxiv - Genomics 2023Quote: ... cDNA was diluted to approximately 3 ng/μL and run on the 2100 Agilent Bioanalyzer using the High Sensitivity DNA Kit (Agilent 5067-4626). The measured fluorescence units in Fig 1b have been corrected for the dilution factor.
-
bioRxiv - Cancer Biology 2023Quote: ... treated with 3% H2O2 to block endogenous peroxidase then incubated in a steamer for 30 minutes in Target Retrieval Solution (Dako, #S1699, #S2367) for antigen retrieval ...
-
bioRxiv - Cell Biology 2023Quote: ... TMEM24(ΔBS + 5S → E)-eGFP was generated using site-directed mutagenesis to remove a portion of the C-terminus of TMEM24(5S → E)-eGFP including the first 3 β-strands of the β-sheet band 4.1 interacting domain (Quik-Change II XL; Agilent Technologies).TMEM24(5S → E)-eGFP which has been previously described (Sun et al. ...