Labshake search
Citations for Agilent :
5501 - 5550 of 6584 citations for Human Short Coiled Coil Protein SCOC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
p110α-dependent hepatocyte signaling is critical for liver gene expression and its rewiring in MASLDbioRxiv - Cell Biology 2024Quote: ... cyanine-3 (Cy3) labeled cRNA was prepared from 200 ng of total RNA using the One-Color Quick Amp Labeling kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... One microgram or more of mouse genomic DNA from each sample was analyzed by whole exome sequencing using the SureSelectXT Mouse All Exon kit (Agilent), followed by next generation sequencing using the NovaSeq 6000 S4 flow cell (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... with the NucleoBond HMW DNA kit (Macherey Nagel, Düren, Germany) and DNA quality was assessed by capillary electrophoresis (Agilent FEMTOpulse). For PacBio library preparation ...
-
bioRxiv - Neuroscience 2024Quote: ... The Lgmn mutation leading to an inactive LGMN C191A variant40,68 was introduced by site-directed mutagenesis using the QuickChange Site-Directed Mutagenesis Kit (# 200519, Agilent Technologies) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2023Quote: ... Final library concentration was assessed by Qubit dsDNA HS Assay Kit (Thermo-Fischer Scientific) and post library QC was performed using Tapestation High Sensitivity D1000 (Agilent) to ensure that fragment sizes were distributed as expected ...
-
bioRxiv - Microbiology 2023Quote: ... The integrity of the RNA was tested on a Bioanalyzer 2100 using the Prokaryote Total RNA Nano kit (Agilent Technologies) and RNA Integrity Numbers (RIN ...
-
bioRxiv - Genomics 2023Quote: ... and resulting size distribution was assessed with the High Sensitivity (HS) Large fragment kit run on the Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were tested for oxygen consumption rate and ATP production following the manufacturer’s instructions for the Seahorse XF Cell Mito Stress Test Kit (Agilent Technologies). Measurements were taken both at baseline prior to mitochondrial stress and following the addition of 2 μM FCCP uncoupling agent.
-
bioRxiv - Biochemistry 2023Quote: ... The NopD point mutants constructs were generated by different primers and were created by the QuickChange site-directed mutagenesis kit (Stratagene). All primers are shown in the Supplementary Table1 ...
-
bioRxiv - Bioengineering 2023Quote: ... The library of CjCas9 variants was produced by random mutagenesis of the wild-type sequence using error-prone PCR approach (GeneMorph II kit from Agilent) (for primers ...
-
bioRxiv - Bioengineering 2023Quote: ... Quality assessment of the isolated RNAs from each condition was conducted using the RNA 6000 Pico Kit and the 2100 Bioanalyzer Systems (Agilent), while quantification was carried out using the Qubit system (Invitrogen) ...
-
bioRxiv - Systems Biology 2023Quote: Oxygen consumption rate was measured with the Seahorse XFe96 bioanalyzer using the Seahorse XF Cell Mito Stress Test Kit (Agilent), or using High-Resolution Respirometry (Oxygraph-2K ...
-
bioRxiv - Cancer Biology 2023Quote: ... The size distribution and quality of the libraries were evaluated using a high sensitivity DNA kit (Agilent Technologies #5067-4626). Quantification of libraries was carried out with the Quant-iT DNA Assay Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified pools were quantified using Qubit dsDNA HS Assay and the quality checked using a Tapestation High Sensitivity D1000 kit (Agilent) to ensure the size distribution of amplicons was as expected ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was quantified by NanoDrop and loaded abundance measured using a Pico 6000 kit and Eukaryotic Total RNA assay on a BioAnalyzer (Agilent).
-
bioRxiv - Genomics 2023Quote: ... and the RNA integrity number (RIN) measured using the standard Agilent RNA 6000 Nano Kit Protocol and BioAnalyzer (Agilent Technologies). Extractions <7 RIN were not sequenced ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were validated using the NGS Kit on the Agilent 5300 Fragment Analyzer (Agilent Technologies, Palo Alto, CA, USA), and quantified with the Qubit 4.0 Fluorometer (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... The library size distribution was determined using an Agilent 2100 Bioanalyzer with the High Sensitivity DNA Kit (5067-4626, Agilent). We next used the SureSelect XT HS reagent Kits (5190-9685 and 5191-6686 ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated by RNeasy Mini or RNeasy Plus Micro Kit and controlled for quality with a 2100 Bioanalyzer (Agilent) prior to cDNA libraries construction ...
-
bioRxiv - Molecular Biology 2023Quote: ... mutant plasmids encoding the different RNA exosomopathy amino acid substitutions were generated by site-directed mutagenesis of the respective wild-type plasmids (pAC3656, pAC3652, pAC3482) using the QuikChange II Site-Directed Mutagenesis Kit (Agilent) and oligonucleotides containing the desired missense mutations as previously described [33 ...
-
bioRxiv - Biochemistry 2023Quote: RNA concentration and purity were determined spectrophotometrically using the Nanodrop ND-8000 (Nanodrop Technologies) and RNA integrity and concentration were assessed using a Fragment Analyzer SS-RNA kit (Agilent). Per sample ...
-
bioRxiv - Cancer Biology 2024Quote: Paraffin-embedded human HCC samples were cut into 3.5-µm thick tissue sections and processed for immunohistochemistry with the EnVision FLEX kit material (K800021-2, Agilent Dako) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... labeled cRNA was prepared from 0.1 micro-g Total RNA using the Low Input Quick Amp Labeling Kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen) and assessed on a BioAnalyzer 2100 (Agilent) for library quantification and quality control ...
-
bioRxiv - Cancer Biology 2023Quote: ... An aliquot of this chromatin was used to assess the size of the DNA fragments obtained by High Sensitivity NGS Fragment Analysis Kit (DNF-474) on a Fragment AnalyzerTM (Agilent). ChIP was performed using IP-Star® Compact Automated System (Diagenode Cat# B03000002 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were washed twice with PBS-Tween and incubated for 30 minutes at room temperature with the Rabbit/Mouse EnVision kits (K4001/K4007, Dako). Slides were counterstained with hematoxylin and ...
-
bioRxiv - Physiology 2024Quote: ... Total RNA was amplified and Cy3-labeled by using the one-color Low Input Quick Amp Labeling Kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Site-directed mutagenesis of this clone was conducted to generate a genomic clone of NRL5P335L using the QuikChange II site-directed mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
Mutations in HUA2 restore flowering in the Arabidopsis trehalose 6-phosphate synthase1 (tps1) mutantbioRxiv - Plant Biology 2024Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit on the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). RNA-seq libraries were generated with three independent biological replicates and sequenced on the Illumina NovaSeq platform by Annoroad Gene Technology ...
-
bioRxiv - Plant Biology 2024Quote: ... Fragmentation (at 60 °C) and hybridization (at 65° C for 16 hours) were done using the Gene Expression Hybridization kit of (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Final libraries were size-selected on Fragment Analyzer using the high-sensitivity Genomic Fragment Analyzer Kit (Agilent, Santa Clara, USA), quantified using the Fluoroskan plate fluorometer (Thermo Fisher Massachusetts ...
-
bioRxiv - Microbiology 2024Quote: To detect changes in neutralisation potency single point mutations were introduced into env encoding plasmids for PV production using the QuikChange Lightning Site-Directed Mutagenesis (SDM) kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cleaned up using the Takara Nucleospin kit per manufacturers protocol and concentration and size range assessed using the D5000 Screentape (Agilent). 200fmol of each sample was barcoded and subject to library prep using the Native Barcoding Ligation Kit with V14 chemistry (SQK-NBD-114-24 ...
-
bioRxiv - Immunology 2023Quote: DNA whole exome libraries of B16-F10 cell line and C57BL/6JOlaHsd germline sample were prepared with Agilent Mouse All Exon kit (Agilent) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 the XF Real-Time ATP Rate Assay Kit (Cat. No. 103592-100, Agilent Technologies, Cedar Creek, TX) was run following the manufacturer’s protocol using the Seahorse XF96 Analyzer as described above.
-
bioRxiv - Microbiology 2024Quote: ... TamA G271C and G574C substitutions were introduced into pXW48 using the QuikChange Site-Drected Mutagenesis Kit (Agilent catalog number 200524). Plasmids that encode bamABCDE8His-bamB (pYG120 ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA quantity and quality were determined using the Agilent RNA 6000 Pico Kit with Bioanalyzer 2100 system (Agilent Technologies, USA). Samples with high purity and RNA Integrity Number (RIN ...
-
bioRxiv - Plant Biology 2024Quote: ... and the quality of RNA based on the RNA Integrity Number was estimated using either the 2100 BioAnalyzer (Cat no: G2939BA; RNA 6000 Nano Kit; Cat no: 5067-1511. Agilent), 5200 Fragment Analyzer (Cat no ...
-
bioRxiv - Plant Biology 2024Quote: ... The quality of the adapter-ligated libraries was checked on the BioAnalyzer High Sensitivity DNA kit (Cat no: 5067-4626. Agilent) or Caliper GX LabChip GX/HT DNA high sensitivity kit (Cat no ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... from these samples (muscle or blood) using Qiagen MagAttract HMW DNA Kit and checked the DNA quality using TapeStation (Agilent), Qubit ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Final library quality was determined by Bioanalyzer 2100 using the Agilent High Sensitivity DNA Kit (Agilent, Cat. No. 5067-4626) and pooled together after normalizing samples based on their quantity from qPCR ...
-
bioRxiv - Immunology 2024Quote: Quantification of both the amplifications and libraries was performed using the Agilent Bioanalyzer High Sensitivity DNA assay (High-Sensitivity DNA Kit, Agilent) and KAPA Library Quantification Kit (Kapa biosynthesis) ...
-
bioRxiv - Developmental Biology 2024Quote: Site-directed mutagenesis of Branchiostoma floridae Pax6 cDNA cloned in pKW mammalian expression vector was performed by the Quick-Change kit (Stratagene) using primers zk2027A/zk2027B to generate Pax6ΔQL ...
-
bioRxiv - Developmental Biology 2024Quote: Donor plasmid PAM sites were mutated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The gRNA-encoding plasmids pU6-BbsI-chiRNA-RhoGEF2 and pU6-BbsI-chiRNA-Cysts were made by insertion of gRNA oligos into pU6-BbsI-chiRNA (Addgene #45946 ...
-
bioRxiv - Biochemistry 2024Quote: The expression vector encoding His-tagged SpNOXDH - aa 181-417 of full-length SpNOX - was obtained from SpNOX by site-directed mutagenesis according to the manufacturer’s protocol (QuikChange® Lightning Site-Directed Mutagenesis Kit, Agilent), using forward primer 5’GTCTGGTCCCGCGTGGCAGTAAAATTAGCTTTCCGTATCTGGG3’ and reverse primer 5’CCCAGATACGGAAAGCTAATTTTACTGCCACGCGGGACCAGAC3’ ...
-
bioRxiv - Microbiology 2024Quote: ... Library quality was assessed using High Sensitivity D1000 kit on a 4200 TapeStation instrument (Agilent Technologies, Santa Clara, CA, USA). The NovaSeq Sequencing System (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies, Santa Clara, CA, USA). DNA libraries suitable for sequencing were prepared from 10 ng of DNase-treated total RNA ...
-
bioRxiv - Microbiology 2024Quote: ... The integrity of the RNAs was verified using the Agilent 2100 bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). RT-pPCR experiments and data analysis were performed as described (19) ...
-
bioRxiv - Genomics 2024Quote: ... cDNA libraries were quantified using the Qubit dsDNA Assay Kit (Thermo, Q32851) and library quality was assessed with the 4150 Tapestation System (Agilent) and D5000 screen tapes (Agilent ...
-
bioRxiv - Genetics 2024Quote: ... The BP-lowering rs1173771 haplotype was then constructed by site directed mutagenesis at the 11 SNPs locations in the haplotype using QuikChange II Site-directed mutagenesis kit (Agilent) and confirmed by Sanger sequencing ...