Labshake search
Citations for Agilent :
5301 - 5350 of 5601 citations for Rat CD325 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... was then mutated to either R to mimic deacetylated c-Myc (K323R) or Q to mimic acetylated c-Myc (K323Q) using QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, 200522-5) against pPHAGE-EF1α-HA-Puro-c-Myc ...
-
bioRxiv - Neuroscience 2022Quote: ... The quality and profile of individual libraries have been quantified and visualized using Qubit™ and the Agilent Bioanalyzer dsDNA High Sensibility Kit (Agilent Technologies, USA) respectively ...
-
bioRxiv - Microbiology 2021Quote: ... This clone was then used to generate single or multiple mutations in the RBD of S gene with site-directed mutagenesis kit (Agilent, Santa Clara, CA) using primers listed in the supplemental Table 2 and designated as pAbVec-SARS2-S (mutant) ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified RNA was then subjected to RNA integrity number (RIN) calculation using the Agilent RNA 6000 Pico kit (Agilent Technologies, Santa Clara, CA). RINs exceeding the Visium optimization threshold of 7.0 were confirmed for sections from all three blocks of interest.(40)
-
bioRxiv - Immunology 2022Quote: ... a variant mutated to change the tyrosines at positions 179 and 181 to phenylalanines was generated using a QuikChange II Site-Directed Mutagenesis Kit (#200523; Agilent, Santa Clara, CA) and the primer 5’ CATCCCCGCCTTCGCCTTCTATGTCTCACGTTGG 3′ ...
-
bioRxiv - Biochemistry 2022Quote: ... The pcDNA3.1 Flag-mRBPJ A284V CRr and the pcDNA3.1 Flag-mRBPJ F261A/A284V CRr were generated via site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies 200521-5) accordingly to manufacturer’s instructions with the oligos listed in Table S6 and using the pcDNA3.1 Flag-mRBPJ WT CRr and the pcDNA3.1 Flag-mRBPJ A284V CRr as templates ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RNA integrity was assessed using an Agilent 2100 Bioanalyzer using an RNA 6000 Nano LabChip kit (Agilent Technologies, Santa Clara, CA, USA). All samples had a 260:280 ratio > 2.0 and an RNA integrity number (RIN ...
-
bioRxiv - Immunology 2022Quote: Specific amino acid changes on envelope clones and CAP206-CH12 heavy chain CDRH3 were introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (catalog #210519, Agilent Technologies, CA, USA). Mutations were confirmed by sequence analysis.
-
bioRxiv - Developmental Biology 2022Quote: ... High quality total RNA (RNA integrity number = 10) was labelled with Cyanine 3 CTP using the Low Input Quick Amp Labelling Kit (Agilent Technologies-5190-2305), and purified using Qiagen’s RNeasy Mini Spin Columns ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... samples were run on an Agilent Bioanalyzer 2100 using an Agilent High Sensitivity DNA Kit as recommended by the manufacturer (Agilent Technologies, Waldbronn, Germany). Concentration of the libraries were determined using the Qubit® dsDNA HS Assay Kit as recommended by the manufacturer (Life Technologies GmbH ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA quality was assessed on 1% agarose gels and with the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). For each sample ...
-
bioRxiv - Microbiology 2021Quote: ... The average sample fragment length and purity was determined using the Agilent High Sensitivity DNA kit and the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA). After passing quality control measures ...
-
bioRxiv - Molecular Biology 2021Quote: ... was used to create fluorescent complementary RNA (cRNA) followed by hybridization to microarrays using Gene Expression Hybridization Kit (Agilent Technologies, Santa Clara, USA). Fluorescence signals were detected using SureScan Microarray Scanner (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... from the pIdsBB expression system containing a C-terminal GFPmut2 fusion (Gibbs et al., 2008) using error-prone PCR with the GeneMorph II Random Mutagenesis Kit (Agilent, Santa Clara, CA) and ligated back into the same pIdsBB expression vector using the restriction enzymes SacI and BamHI ...
-
bioRxiv - Molecular Biology 2020Quote: ... samples were then loaded in equal volumes into 24 wells of an Agilent 3100 OFFGEL Fractionator using a high-resolution fractionation kit (Agilent Cat#5067-0201). Each sample ...
-
bioRxiv - Immunology 2020Quote: ... The amplified total cDNAs were analyzed by an Agilent 2100 Bioanalyzer using the Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA) and sheared to 150bp on the Covaris S2 machine (Covaris ...
-
bioRxiv - Immunology 2020Quote: ... Approximately 400 ng of amplified cDNA was used to generate the Illumina sequencing library using the Agilent SureSelectXT Target Enrichment Kit (Agilent, Santa Clara, CA) for Illumina Multiplex Sequencing by using enrichment probes designed for A/California/04/2009(H1N1 ...
-
bioRxiv - Biophysics 2020Quote: ... A thrombin site was introduced between the 6xHis-tag and the coiled-coil using the QuikChange Lightning mutagenesis kit (Agilent, Santa Clara, USA). Sequences of the products were confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... RNA quality and quantity were determined using Agilent RNA6000 Nano kit by capillary electrophoresis (Agilent 2100 bioanalyzer, Agilent Technologies, Santa Clara, CA, USA). cDNA was synthesized from 1 μg of total RNA using oligo-dT primer and Superscript III reverse transcriptase (RT ...
-
bioRxiv - Microbiology 2022Quote: ... and H249A were generated from the parent pLVX Kernow C1/p6 ORF1AAAPG-Ha tag-AAAPG IRES zsGreen construct via QuikChange XL site-directed mutagenesis kit (Stratagene, La Jolla, CA). using primers listed in (Supplementary Table 1).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Library qualities were assessed with the High Sensitivity D1000 ScreenTape Assay Kit and the Agilent 4200 TapeStation system (Agilent, Santa Clara, United States). The libraries of all three insect species were sequenced on NovaSeq 6000 at the Institute of Clinical Molecular Biology (IKMB ...
-
bioRxiv - Immunology 2022Quote: ... Total amounts and integrity of RNA were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). mRNA was purified from total RNA by using poly-T oligo-attached magnetic beads ...
-
bioRxiv - Genetics 2019Quote: ... Glu2759Cysfs*9 and G2003R were introduced into a wild-type (WT) pEGFP-FBN1 QuikChange Lightning Site-directed Mutagenesis Kit (Agilent Technologies, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... FLAG-tag was inserted between the CAAX motif (CVIQ) and stop codon in the full-length construct (Cat No: 200523, QuickChange II Site-Directed Mutagenesis kit, Agilent Technologies, Lexington, MA). For removal of the INF2 cleavage site ...
-
bioRxiv - Plant Biology 2019Quote: ... Quality and quantity of each RNA sample were checked using an Agilent RNA 6000 Nano Kit Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). All RNA samples were stored at −80°C.
-
bioRxiv - Genetics 2020Quote: ... the exonic regions and flanking splice junctions of the genome were captured using the Clinical Research Exome kit (Agilent Technologies, Santa Clara, CA). Massively parallel (NextGen ...
-
bioRxiv - Cancer Biology 2020Quote: ... The quality of the library was assessed using High Sensitivity D1000 kit on a 2200 TapeStation instrument (Agilent Technologies, Santa Clara, CA, USA). Sequencing was performed using the NovaSeq 6000 Sequencing System (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... The mutated variants of AopW1 were generated by inserting mutations in the corresponding primers in combination with the Quick Change Lightening Site Directed Mutagenesis kit (Agilent Technologies, SC, USA). For this purpose ...
-
bioRxiv - Plant Biology 2020Quote: ... Site-directed mutagenesis to generate the different H3.1 point mutant constructs was performed using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The ADA2b coding sequence was cloned into pETDuet-1 (Millipore ...
-
bioRxiv - Immunology 2021Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative PCR of complementary DNA was performed using the DyNAmo HS SYBR Green kit (Thermo-Fisher, Cat # F410L) on an Mx3000P machine (Stratagene, La Jolla, CA) using the primers listed in Supplementary File 3 ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were pooled in equal quantity and combined to multiplex to make a final library and QC was done again using Qubit quantification kit and Agilent bioanalyzer using high sensitivity DNA chip (Agilent Biotechnology, 5067-4626). The final combined library was sequenced using Illumina technology on NextSeq 500 sequencer using mid output 150-bp paired-end (PE ...
-
bioRxiv - Systems Biology 2019Quote: ... fluorescent chemistry and 1 ng was used to obtain RNA Integrity Number (RIN) using the Bioanalyzer RNA 6000 Pico kit (Agilent Technologies, 5067-1513). Lowest RIN was 9.5 ...
-
bioRxiv - Plant Biology 2019Quote: ... Mutations found in Bgh51 of Australian isolates were introduced into pYES-Bgh51wt through a QuickChange II site-directed mutagenesis kit (Stratagene, La Jolla, CA).
-
bioRxiv - Evolutionary Biology 2019Quote: ... of total cytoplasmic RNA was quantified by an Agilent 2100 Bioanalyzer using an Agilent RNA 6000 Nano Kit (#5067-1511, Agilent, Santa Clara, CA). Samples with a total cytoplasmic RNA average RIN value of 7.5±0.16 were used for RNA-seq library preparation of the nuclear samples ...
-
bioRxiv - Genomics 2021Quote: ... and the library profiles were assessed using a DNA High Sensitivity LabChip kit on an Agilent Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The libraries were sequenced on an Illumina HiSeq2500 instrument (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... The integrity of RNA was assessed with an RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Physiology 2021Quote: ... Amino acid substitution mutants were generated by site-directed mutagenesis using a QuickChange site-directed mutagenesis kit (Agilent Technologies, La Jolla, CA, USA). The predicted DNA sequences of all constructs were verified by sequencing.
-
bioRxiv - Biochemistry 2021Quote: ... Single amino acid changes in the RBD (N501Y, E484K, K417N) and combinations thereof were introduced using QuikChange (XL Site-Directed Mutagenesis Kit, Agilent, Santa Clara, USA). Resulting expression plasmids were purified using Nucleobond Xtra maxi ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... The N322Q mutation was introduced into ACE2-wt-Fc and ACE2-T92Q-Fc using the QuikChange Lightning Site-Directed-Mutagenesis kit (Agilent Technologies, United States) according to the manufacturer’s instructions and the respective parental vector as template ...
-
bioRxiv - Cancer Biology 2020Quote: ... The slides were thawed at room temperature for 15 minutes prior to immunohistochemistry staining using Envision+ Dual Link System-HRP (DAB+) kit (DAKO, Carpinteria, CA, USA). Following fixation in 95% ethanol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The average sample fragment length and purity was determined using the Agilent High Sensitivity DNA kit and the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA). After passing quality control measures ...
-
bioRxiv - Biophysics 2021Quote: ... Six mutants of TDP-43 PLD were further generated by use of QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, United States) (16).
-
bioRxiv - Cell Biology 2020Quote: ... while those extracted from LCM-islets were quantified using 2100 Bioanalyzer-RNA 6000 Pico Kit (cat. 50671513, Agilent Technologies, Santa Clara, CA, USA) as well as RNA integrity (RIN) ...
-
bioRxiv - Cell Biology 2021Quote: ... Coding regions and intron/exon boundaries were sequenced on the Novogen platform (agilent v6, HiSeqX,) after enrichment with Agilent kits (Agilent Technologies, Wokingham, UK). Exomes data were analysed using a bioinformatics pipeline developed in-house using two modules ...
-
bioRxiv - Immunology 2021Quote: ... in order to modify its DAG discrimination capacity 17 by replacing Gly652 with Ala (G652A) using the Quick-Change XL site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the oligonucleotides described in Table 1 ...
-
bioRxiv - Immunology 2021Quote: Final V(D)J and 5’ GEX libraries were run on a Bioanalyzer 2100 with a High Sensitivity DNA kit (Agilent, Santa Clara, CA) to assess library size and concentration ...
-
bioRxiv - Immunology 2021Quote: ... cDNA amplification was carried out at 13 cycles of amplification for all samples and assayed for quality and concentration using a Bioanalyzer 2100 and High Sensitivity DNA Kit (Agilent, Santa Clara, CA).
-
bioRxiv - Genetics 2020Quote: ... a natural NcoI restriction enzyme site located within intron 3 of the SPINK1 gene in the context of the previously constructed Mut expression vector was firstly eliminated by means of the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent, Les Ulis, France) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The average length of the indexed cDNA libraries was determined with a 2100 Bioanalyzer using the Bioanalyzer High Sensitivity DNA kit (Agilent, cat.no.:5067-4626), concentrations were measured using a Qubit dsDNA HS Assay Kit (Thermofisher ...