Labshake search
Citations for Agilent :
451 - 500 of 3885 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and luminescence measured on a Cytation 5 instrument (Agilent). The luminescence inhibited by Z-YVAD-FMK corresponds to specific caspase-1 activity ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse phase S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Microbiology 2024Quote: ... in digital wide-field microscopy (BioTek Cytation 5, Agilent). Automated Image capturing was performed at 10 minute intervals using a 10X objective and the BioTek Gen5 Software ...
-
bioRxiv - Molecular Biology 2024Quote: ... and analyzed by Cytation 5 (Agilent, CA, United States). Cells seeded in 6-well plates were used for PCR or Western Blotting.
-
bioRxiv - Cancer Biology 2024Quote: ... Luminescence was measured using the Cytation 5 (Agilent Technologies).
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse phase S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Developmental Biology 2021Quote: ... The antigen retrieval was achieved with 3 min proteinase K treatment (S3020, Agilent), and the sections were washed in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... both packed with Polaris C18-A 3-μm material (all from Agilent Corp.). After injection of the sample onto the trapping column ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Microbiology 2022Quote: ... Agilent SEC-3 300-Å HPLC column (Agilent Technologies, cat. no. 5190-2511) was used to purify tRNA from total RNA with a temperature-controlled column compartment at 40 °C with 100 mM ammonium acetate aqueous phase at a flow rate of 1 ml/min ...
-
bioRxiv - Developmental Biology 2021Quote: ... and all antibodies (Supplemental Table 3) diluted in antibody diluent solution (DAKO, S0809). Secondary staining was performed for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent) using GeneJammer (Agilent) in 10% FBS/DMEM enriched with 1% Pennicilin/Streptomycin (D10 medium) ...
-
bioRxiv - Immunology 2020Quote: ... For immunohistochemistry the antibodies detailed in follow were used: AE1/3 (Dako/IR053), TTF-1 (Dako/IR056) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... For separation a Zorbax RRHD Eclipse XDB C18 column (1.8µm, 3×50mm; Agilent) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3×10 minutes with PBS again and mounted using glycergel (Dako, Cat.N.C0563). The imaging was performed with the use of ZEISS microscopes ...
-
bioRxiv - Biochemistry 2024Quote: ... The column used was Bio-SEC-3 130 Å 4.6/300 (Agilent Technologies). All samples were run in 20 mM HEPES ...
-
bioRxiv - Microbiology 2024Quote: ... The size exclusion analytical column (Bio-SEC-3, Agilent, Santa Clara, CA, USA) was loaded with 50-µl of protein at a concentration of 3.0 mg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: 3 µm thin TMA sections were mounted on Flex microscope slides (Agilent Technologies) and dried at room temperature (RT ...
-
bioRxiv - Immunology 2024Quote: ... with a guard column Zorbax Extend C18 (3 × 5mm, 1.8μm; Agilent, Waldbronn, Germany), both maintained at 60°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBST for 1 h at RT Sections were incubated overnight at RT in primary antibody rabbit anti-GFAP (Agilent, Dako Z0334,1:500 in 5 % NGS-PBST) and then with biotinylated secondary antibody anti-rabbit IgG (H+L ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Neuroscience 2024Quote: ... and counter stained for 5 minutes with automated hematoxylin (DAKO). Slides were then dehydrated through alcohol gradients and xylene before being coverslipped.
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases of first-step HPLC separation were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The column (C18, 5 µm, 250 × 4.6 mm, Agilent, USA) was eluted at 30 °C using acetonitrile/water (4/6 ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 30min and imaged on the Cytation 5 (Agilent Technologies) using DAPI and RFP filters/LED cubes ...
-
bioRxiv - Cancer Biology 2024Quote: ... every 2nd day with a Cytation 5 instrument (Agilent Technologies). On day 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were read using a BioTek Cytation 5 (Agilent Technologies) wide-field imaging reader with a 20x air objective ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBST for 1 h at RT Sections were incubated overnight at RT in primary antibody rabbit anti-GFAP (Agilent, Dako Z0334,1:500 in 5 % NGS-PBST) and then with biotinylated secondary antibody anti-rabbit IgG (H+L ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Cell Biology 2022Quote: ... 3 μl of cell suspension were mixed with 10ul of fluorescence mounting medium (Dako) and mounted for downstream confocal imaging ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...