Labshake search
Citations for Origene Technologies :
301 - 350 of 432 citations for Primary Human Arterial Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Physiology 2023Quote: ... were transiently transfected as described above with a plasmid encoding C-terminal Myc-FLAG epitope-tagged human TMEM65 (TMEM65-Myc-FLAG) (Origene #RC207368; NM_194291). Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001 ...
-
bioRxiv - Cancer Biology 2019Quote: Overexpression of LPL was performed using a human LPL clone in pCMV-6AC plasmid vector synthesized by OriGene (Rockville, MD; Cat. No. SC322258). An empty pCMV-6AC (“pCMV Neo” ...
-
bioRxiv - Microbiology 2020Quote: ... pRS-derived retroviral vectors expressing a scramble shRNA and shRNA targeting the mRNA of human LY6E were obtained from OriGene (Cat. No. TR311641).
-
bioRxiv - Molecular Biology 2020Quote: ... or JetPRIME for 293T cells (PolyPlus) or Turbofectin for HAP1 cells (OriGene), following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293T cells were obtained from Origene and cultured in DMEM containing 10% fetal bovine serum and 2mM L-glutamine (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable cell lines were stablished transducing cells with a set of 4 shRNAs against Mdm2 (Origene, cat.#TL311529) or shRNA negative control (Origene ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were transfected with Turbofectin 8.0 (Origene). For all dOTS experiments ...
-
bioRxiv - Genetics 2021Quote: ... When cells reached ∼80% confluency cells were transiently transfected with NDUFAF1(NM_016013) C-Myc/DDK-tagged plasmid (Origene #RC200029) with Lipofectamine 3000 (Thermo #L3000001 ...
-
bioRxiv - Cell Biology 2021Quote: ... HAP1 cells were transfected using TurboFectin 8.0 (Origene) according to the manufacturer’s instructions with a plasmid encoding spCas9 and an sgRNA targeting the C-terminal sequence of KPNA2 (5’-AGGCTACACTTTCCAAGTTC-3’) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells transfected with plasmids expressing Ube2e1 shRNA (Origene) were selected for using 0.5μg/ml puromycin for 5 passages ...
-
bioRxiv - Genomics 2021Quote: ... HAP1 cells were transfected using turbofectin (Origene, TF81001) following the manufacturer’s recommendations.
-
bioRxiv - Biophysics 2022Quote: ... Cells were transfected using Turbofectin 8.0 (OriGene Technologies) with 0.125 μg GFP cDNA and 0.25 μg of 8A and 8C-8A(IL125) ...
-
bioRxiv - Genomics 2023Quote: ... HAP1 cells were transfected using Turbofectin 8.0 (Origene). All oligos and primers were synthesized by Integrated DNA Technologies.
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+ and HEK293/GC-B+ cell lines were generated from HEK293 parental cell transfected with plasmids (OriGene, Rockville, MD) containing either human GC-A or GC-B cDNA sequences ...
-
bioRxiv - Neuroscience 2022Quote: Stable knockdown of Cebpg in 50B11 cells was done by transfecting 50B11 cells with pGFP-C-shLenti carrying shRNA against Cebpg (1µg/ml; TL709448; Origene, Rockville, MD) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... A549-expressing human ACE2 (A549ACE2) cells were generated by transducing A549 cells with the ACE2-expressing lentiviral vector (pLenti-C-mGFP-ACE2) (Origene, Cat# PS100093) and then selected with puromycin according to the manufacturer’s procedure.
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with an empty vector (PCMV6XL5, Origene). Cells were incubated at 37 °C in 5% CO2 for a total of 48 h.
-
bioRxiv - Cell Biology 2020Quote: ... Cells transfected with nonspecific control siRNA (SR30004, OriGene, USA) were used as the control ...
-
bioRxiv - Developmental Biology 2019Quote: 293T cells were transfected with FOLR1-myc constructs (Origene #RC212291using Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were treated with siRNAs (Origene 10 ng/uL) and stimulants (NGF ...
-
bioRxiv - Cell Biology 2019Quote: ... OVCA429 cells were transfected with GFP-mDia2 shRNA constructs (Origene) using Fugene (Promega (Madison ...
-
bioRxiv - Cell Biology 2019Quote: ... and PAK2 were amplified from cDNA library (Jurkat cells, Origene) by PCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were transfected with 3 μL of Turbofectin 8.0 (Origene) and 1,000 ng of total DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transiently transfected with control siRNA duplex (OriGene #SR30002) and two Stealth siRNAs targeting ELP3 (ELP3 siRNA1(OriGene#SR310519A ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were transfected with plasmid (pCMV6-entry from Origene) and siRNA constructs (Santa Cruz Biotechnology ...
-
bioRxiv - Biophysics 2020Quote: ... and HAP-EAP45 KO cells were transfected with Turbofectin (OriGene). Both the SNAP-expressor rescue experiment and the transfection of piGFP in HAP1-EAP45 KO cells were done similarly as described before (26) ...
-
bioRxiv - Cancer Biology 2019Quote: MRC5 cells were transfected with pCMV-PIK3Cδ-AC-GFP (Origene) or empty vector using 4-D electroporator (LONZA) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were silenced with Calcineurin siRNA oligo duplex (OriGene, SR416619) by direct transfection ...
-
bioRxiv - Physiology 2023Quote: ... Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001) as a negative control ...
-
bioRxiv - Cell Biology 2019Quote: ... Control cells were generated using empty pGFP-V-RS vector (Origene). Cells were then further selected for GFP through flow cytometry using the FACS Aria Ilu High-Speed Cell Sorter (BD Biosciences (Franklin Lakes ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were transfected with pCMV6-Myc-DDK-MCM10 (OriGene, Rockville, MD) and control vector using ViaFect Transfection Reagent (Promega ...
-
bioRxiv - Cell Biology 2024Quote: NIH3T3 cells were transfected with Mecp2 (Origene, CA, USA, #MR226839, #MR207745) or Nedd4 (Origene ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were transfected with Myc-DDK-tagged Rho-GDI1 (ARHGDIA) (MR202112 OriGene) using Lipofectamine 3000 (L3000015 Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were transfected with siRNA using siTran 1.0 transfection reagent (Origene, TT300003) added to cells in DMEM/10% FBE growth medium for 1 day ...
-
bioRxiv - Cell Biology 2019Quote: ... We transfected HeLa cells with pCMV6-AC-IL2R-GFP (Origene plasmid #RG215768) using TransIT®-2020 transfection reagent (Mirus ...
-
bioRxiv - Genetics 2020Quote: ... cells were fixed and stained with an anti-DDK antibody (OriGene, TA50011), and actin and dapi probes as described for immunofluorescence above ...
-
bioRxiv - Cell Biology 2020Quote: ... the gene for NPM was amplified from cDNA library (Jurkat cells, Origene) by PCR and inserted to vectors peGFP-C2 and pmRFP1-C2 (originally Clontech) ...
-
bioRxiv - Molecular Biology 2021Quote: ... YTHDC1 mRNA knockdown in 293T cells was performed using siRNAs (Origene # SR314128) transfected using Lipofectamine RNAiMax (Invitrogen).
-
bioRxiv - Immunology 2020Quote: ... HEK293T cells were individually transfected with plasmids encoding for secreted proteins (OriGene Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmids for overexpression in HEK293T cells were purchased from OriGene (Rockville, MD): pCMV6 (PS10001) ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were infected with lentiviral carrying shRNA specific to DCP1a (OriGene) or DCP1b (OriGene ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEI-OC1 cells were transfected with a mouse Tlr4 expression clone (Origene; MR210887) to test for complementation of the Tlr4 deletion strain ...
-
bioRxiv - Cancer Biology 2020Quote: ... a specified amount of plasmid was transfected into cells using Turbofectin 8.0 (Origene) by following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2019Quote: ... shWRNIP1 cell line was generated by stably expressing shRNA against WRNIP1 (shWRNIP1) (OriGene). Cells were cultured in the presence of puromycin (100 ng/ml ...
-
bioRxiv - Biochemistry 2021Quote: U2OS-WT cells were plated and transfected with the pCas9-Guide (Origene GE100002) constructs using Lipofectamine 2000 overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells transduced with the empty pLenti-C-mGFP-P2A-Puro vector (PS100093, OriGene), (HT29GFP and Caco2GFP ...
-
bioRxiv - Pathology 2022Quote: HEK293 cells were transiently transfected with overexpressing plasmids for IL-31RA (Origene, RC218212L1) and CHRM3 (Origene ...
-
bioRxiv - Immunology 2022Quote: ... cells were transduced with pLenti BCL6 ORF-mGFP or empty mGFP only (Origene).