Labshake search
Citations for Origene Technologies :
1 - 50 of 432 citations for Primary Human Arterial Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Immunology 2020Quote: ... HEK293T cells stably expressing GFP-tagged human ACE2 (Origene) were generated using the same methodology ...
-
bioRxiv - Biochemistry 2023Quote: Human cell derived recombinant eIF2A-FLAG was expressed in HEK293T cells obtained commercially (OriGene # TP304303) and buffer exchanged into Protein Storage Buffer (25 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK cells were co-transfected with human flag-tagged PP1R6 (Origene) and His6-tagged VASP (Benz et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Recombinant human NAT10 derived from 293T cells was purchased from Origene Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with Twist (TWIST1) (NM_000474) Human Tagged ORF Clone (Origene). Transfected cells underwent 3 weeks selection procedure with Neomycin (400 µg/ml) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with a vector expressing GFP-tagged human FXR (NM_001206979, OriGene) by using X-tremeGENE HP DNA Transfection Reagent (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2023Quote: ... or 10 μg human ACSS2-overexpressing HEK-293 cell lysate (ref. LY412981, Origene, MD ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Neuroscience 2023Quote: ... human GBA (Origene), human a-SYN (A53T mutant ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Microbiology 2022Quote: Human CD164 (Origene, #RC202234) and mouse Cd164 (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transiently transfected with a human KLK10-encoding plasmid (pCMV6-KLK10-Myc-DDK; Origene RC201139) at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Genomics 2023Quote: ... The oligoribonucleotides were incubated with either 10 µg HuR overexpressing HeLa cell whole cell extracts or 25-200 µM ELAVL1 human recombinant protein (Origene, Rockville, MD) in a 20 µL reaction mixture with 20 units of RNasin and 1X RNA binding buffer containing 20 mM HEPES (pH 7.6) ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...
-
bioRxiv - Physiology 2023Quote: Human AgRP (Origene CAT#: RC217144) was cloned into CAG-NLS-GFP (Addgene# ...
-
bioRxiv - Cell Biology 2023Quote: ... human FBXO38 cDNA (Origene #RC204380) was cloned into pcDNA3.1 containing N-terminal twinStrepII- FLAG-tag (NSF) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SNAP43 (SNAPC1) (Origene, TP760339), Human MBP (gift of A ...
-
bioRxiv - Neuroscience 2023Quote: ... or human ELP1 (Origene RC2076868), ELP1 (NM_003640) ...
-
bioRxiv - Cancer Biology 2023Quote: Myc-Flag-human TEADs (OriGene) and V5-ubiquitin (generated in house ...
-
bioRxiv - Cancer Biology 2023Quote: Human SFRP1 (Origene plasmid #RC207328) or Notum (Gateway ORF clone ID #164485821 ...
-
bioRxiv - Biochemistry 2022Quote: D-cysteine transport experiments were performed in HEK293 cells transiently transfected with human SLC1A15 (ASCT2; Origene; Cat# RC200305) and rat SLC7A10 (Asc1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies used included Ki67 (ORIGENE, TA802544) and cleaved caspase-3 (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2020Quote: ... human FGF1-myc-DDK (Origene RC207434), human flag-FGF2 (SinoBiological HG10014-NF) ...
-
bioRxiv - Cancer Biology 2020Quote: ... CXCR4 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Biochemistry 2022Quote: ... human testis FFPE tissue (Origene, CB811079) was first sliced ...
-
bioRxiv - Cell Biology 2021Quote: ... or human GPR87 ORF (Origene, RC218486L3)) for 6 hrs ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human IL-1β (Origene #RC202079L4) plasmid constructs were used for generating stable LNCaP cells ...
-
bioRxiv - Cancer Biology 2020Quote: DUSP1 human overexpression plasmid (Origene, NM_004417) was expanded and transfected into 451Lu BRAFi-R and 1205Lu BRAFi-R cells using jetPRIME® transfection reagent (Polyplus transfection) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human MTERF (MTERF1) (Origene, TP761846). Proteins injected were serially diluted (two-fold each step ...
-
bioRxiv - Neuroscience 2023Quote: The human GPR37L1 cDNA clone (Origene) was subcloned into pcDNA3.1+ (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: Human CYP4F2-myc-DDK (OriGene RC216427), human
-
bioRxiv - Physiology 2023Quote: Human SLC8B1 cDNA (Origene #RC214624; NM_024959) was PCR amplified using primers to introduce a 5′ AgeI restriction site and a 3′ BamHI restriction site flanking the coding sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human Dlk2 pCMV6 (RC210622, Origene) vectors ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified human recombinant NRXN3 TP323448 (Origene) was used as standard ...
-
bioRxiv - Cancer Biology 2020Quote: ... 22Rv1 SLFN5 KO cells were further transfected with SLC7A5 (NM_003486) Human Tagged ORF Clone (RC207604, Origene, Rockville, MD, USA). Cells were then clonally selected ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human p97/VCP (NM_007126, SC125280), human UFD1L (NM_005659, SC320168), and human NPLOC4 (NM_017921, SC113845) expression plasmids were purchased from OriGene.
-
bioRxiv - Neuroscience 2024Quote: ... we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (Origene, #225495) using a Q5® Site-Directed Mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Bioengineering 2022Quote: Anti-HER2 monoclonal antibodies were used as primary antibodies in a series of Western Blots on cellular lysates of wild-type HEK293T (non-expressing HER2) cells (Origene LY500001) and HEK293T overexpressing HER2 (Origene LY417979) ...
-
bioRxiv - Cell Biology 2023Quote: ... transient or tetracyclin-inducible expression of human HEATR5B with an N-terminal GFP tag in human cells) were cloned by Gibson assembly with the full-length human HEATR5B open reading frame (derived from plasmid RC22610 (Origene)) and either pcDNA3.1-eGFP-linker or pcDNA5-FRT/TO-eGFP-linker plasmids (coding for eGFP and a GGSGGSGG linker ...
-
bioRxiv - Cell Biology 2023Quote: A recombinant hCABS1 overexpression lysate (OEL) produced in Human Embryonic Kidney 293T (HEK293T) cells (OriGene Technologies Inc., Rockville, MD, USA) was used as a positive control in WB ...
-
bioRxiv - Molecular Biology 2024Quote: NSC34 and HEK293T cells were transfected with a plasmid coding for the hnRNPA2B1 (NM_002137) Human Tagged ORF Clone (Origene, RC219318) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen L3000001) ...