Labshake search
Citations for Origene Technologies :
201 - 250 of 521 citations for Myc Box Dependent Interacting Protein 1 BIN1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... with mouse monoclonal anti-FLAG antibody (anti-DDK; 1:1,000, OriGene) in blocking solution for 2–3 days ...
-
bioRxiv - Cell Biology 2021Quote: Constructs of individual c-myc tagged human TRAP subunits (α, β, δ) under the CMV promotor were purchased from OriGene Technologies (#RC202408 ...
-
bioRxiv - Genetics 2022Quote: ... and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536, Origene, Maryland, USA). After 24 h cells were treated with 10µM monensin and immunofluorescence analysis was done as explained above ...
-
bioRxiv - Cancer Biology 2019Quote: The Myc-DDK-tagged ORF clone of Homo Sapiens MAN1B1 or pCMV6-Entry (RC202824 and PS100001, respectively, Origene, Rockville, MD) vectors were transfected in LNCaP ...
-
bioRxiv - Neuroscience 2019Quote: ... GFP-tagged Kv4.2 (Cat# MG209597) and Myc-tagged Kv4.3 (Cat# MR221003) expression constructs were purchased from OriGene (Rockville, MD, USA).
-
bioRxiv - Cell Biology 2020Quote: A non-tagged construct of mouse Gdf3 was generated using the commercial vector pCMV6-Gdf3-Myc-Flag (OriGene Technologies, MR222967), containing a Myc-Flag-tagged Gdf3 ...
-
bioRxiv - Neuroscience 2020Quote: ... MG87.TRKA and MG87.TRKB cells were transfected with PTPσ (RefSeq number NM_019140) Myc-DDK-tagged open-reading frame (ORF) plasmid purchased from OriGene (#RR209636), pCMV6-Entry vector with C-terminal Myc-DDK Tag (#PS100001 ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid containing source cDNA sequence for Mus musculus MIM (NM_144800) with C-terminal myc- and FLAG-tag was purchased from Origene (MR210506). All plasmids were sequenced to confirm the correct coding sequence (Eton Bioscience).
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Biochemistry 2023Quote: Plasmid pCMV6 encoding cDNA for human RHBDL2 and RHBDL4 with a C-terminal myc-FLAG tag was obtained from OriGene, USA ...
-
bioRxiv - Biochemistry 2023Quote: ... GFP-tagged-RADIF was obtained by restriction digestion from Lenti-Myc-FLAG-RADIF using AsiSI and MluI and cloning into a pCMV6-AC-GFP vector originally obtained from Origene. gRNA-target-resistant constructs were generated by site directed mutagenesis using QuikChange II Site-directed mutagenesis kit (200521 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The OC2 overexpression construct was generated by cloning the full-length OC2 cDNA (NM_004852) into the pLenti-C-Myc-DDK-IRES-Puro (Origene #PS10069) lenti-virus system ...
-
bioRxiv - Cell Biology 2024Quote: ... pLenti-C-Myc-DDK (RC210158L1; carrying the ORF of human CX36; GJD2; NM_020660) was obtained from Origene (Rockville, Md, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... Single cells were then expanded to larger culture volumes and were screened for a reduction in Foxc1 protein levels by immunoblotting with anti Foxc1 antibodies (Origene), followed by sequencing of the Foxc1 ORF ...
-
bioRxiv - Cancer Biology 2020Quote: The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase):
-
bioRxiv - Genetics 2022Quote: ... For WDR34p.Arg183Trp and WDR34p.Gly394Ser mutants cells were transfected with WDR34 human Myc-DDK-tagged tagged ORF Clone (RC204288, OriGene, Rockville, Maryland, USA) and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536 ...
-
bioRxiv - Physiology 2021Quote: ... the pRL-TK renilla luciferase vector as an internal control and varying concentration of a CASR containing a myc tag vector (Origene Inc.). After 24 hr incubation with standard medium containing 1.5 mM calcium the cells were assayed for Cldn14 reporter expression using a luciferase assay system from Pormega Corp ...
-
bioRxiv - Biochemistry 2023Quote: ... the lateral and contralateral tibialis anterior were injected with 30 µg of either control empty vector pCMV6 or Nr2f6-myc-flag overexpression plasmid (Origene, #MR206083) and 220V/cm were applied in 8 pulses of 20/200 ms on/off (ECM 830 Electroporator ...
-
bioRxiv - Microbiology 2024Quote: ... seed in a 6-well plate were transiently co-transfected with 200 ng of a myc-tagged FOS (pCMV6-FOS, OriGene, RC202597) and 600 ng of a wt ORF57 (pVM7 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The primary antibodies used were: rabbit anti-GFP (1:500; Origene TP401), mouse anti-GFP (1:500 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The primary antibody anti-DDK (FLAG®) (OriGene Technologies, TA50011, 1:1000) was used for detection of proteins overexpressed from the pCMV6-entry vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were incubated overnight: TRIM24 (1:200, TA802797, Origene), TRIM33 (1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal antibody against IL-1β (Origene Inc., Cat# TA506443, 1:1000), rabbit polyclonal antibody against p65 (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... or a dilution of 1/1,000 anti-turboGFP chicken antibody (Origene; TA150075) respectively ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary antibodies pan cytokeratin (PanCK, 1:100, OriGene Catalog # CF190032, Lot # F003) and vimentin (VIM ...
-
bioRxiv - Cell Biology 2021Quote: The plasmid-based expression construct pcDNA4/TO-GFP-CLC7 was generated by amplifying the CLC7 insert of pCMV6-CLC7-Myc-FLAG (RC203450, Origene, Rockville, MD) using PCR with a forward primer (5’-CATCATAAGCTTGGAGCTATGG CCAACGTCTCTAAGAAGGTGTC ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse Irx3 (NM_008393) was amplified by PCR from the donor vector pCMV6-entry-Irx3-myc-DDK (cat. no MR208149, Origene, Rockville, MD, USA) with the following forward 5’-CGATCTAAGTAAGCTTCACCATGTCCTTCCCCCAGCTCG-3’ and reverse 5’-GATCTTGGCAAAGCTTAGACGAGGAGAGAGCTGATAAGACC-3’ primers ...
-
bioRxiv - Microbiology 2021Quote: ... MLV P30 protein within the pseudovirus capsid was detected using a rabbit anti-MLV-P30 polyclonal antibody (Origene, Cat. No. AP33447PU-N) and an HRP-conjugated goat anti-rabbit IgG Fc secondary antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: The following primary antibodies were used: Goat anti-GFP (Origene; R1091P; 1:200), rabbit polyclonal anti-keratin 5 (BioLegend ...
-
bioRxiv - Cell Biology 2021Quote: ... The following primary antibodies were used: anti-mCherry (AB0040-200, Origene, 1:500), anti-myc 9E10 (13-2500 ...
-
bioRxiv - Neuroscience 2021Quote: ... and guinea pig anti-Drebrin polyclonal antibody (1:100, OriGene Technologies, Herford, Germany). Neural dendrites were detected with the neurofilament marker anti-SMI 311 mouse monoclonal antibody (1:600 ...
-
bioRxiv - Neuroscience 2023Quote: ... and then incubated with goat anti-tdTomato antibody (1:300, Origene, # AB8181-200), rabbit anti-St8sia1 (GD3S ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Cancer Biology 2020Quote: A Myc-DDK-tagged ORF clone of TCF4 and the negative control pCMV6 were used for in transient transfection (RC224345; OriGene, Rockville, Maryland, USA) using previously described methodology 37 ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing the Tantalus domain and SLiM sequence by PCR amplification of the required coding region with insertion into pCMV6-AC-Myc-DDK (Origene, Rockville, MD, USA) using an In-Fusion HD Cloning Plus kit (Takara Bio ...
-
bioRxiv - Immunology 2024Quote: mRNA was synthesized encompassing the open reading frame of a fusion protein coding for the full-length ANKRD55 isoform 201 coupled to C-terminal MYC-FLAG tags as provided by a commercial vector (Origene, Cat. No. RC221211). Unmodified synthesized ANKRD55 mRNA transcript was capped at the 5’ end using wild-type bases CleanCap® AG (TriLink BioTechnologies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the membrane was incubated overnight at 4°C with primary antibody solution (1:1000 dilution for anti-TSG101 [Abcam, ab30871], anti-Calnexin [ThermoFisher, PA5-19169] and anti-Syntenin-1 [Origene, TA504796] ...
-
bioRxiv - Microbiology 2020Quote: ... FLAG-tagged MtTop1 was detected with anti-DDK (FLAG) antibodies (Origene, TA50011, 1:2,500). Membranes were incubated with primary antibodies at room temperature for 3 hr ...
-
bioRxiv - Cell Biology 2021Quote: ... Antibodies or reagents used were: (i) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD49d-BV421 (1:100 dilution ...
-
bioRxiv - Bioengineering 2022Quote: ... Antibodies or reagents used were: (i) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD49d-BV421 (1:100 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: goat anti-mCherry (Origene, AB0040-200, 1:500), mouse anti-His (Dianova ...
-
bioRxiv - Cancer Biology 2022Quote: The expression plasmids pCMV6-Entry-Empty and pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc were purchased from Origene (Tema Ricerca, Bologna, Italy). pGL3-NF-κb reporter ...
-
bioRxiv - Cancer Biology 2020Quote: The following antibodies were used for immunoblotting following the manufacturer’s recommendations: anti-RIOK2 (1:1000, Sigma HPA005681; 1:1000, Origene Clone OTI3E11), anti-IMP3 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Cell Biology 2020Quote: ... the samples were immunostained with the anti-IRSp53/BAIAP2 antibody 1D9 (mouse monoclonal, 1:200, OriGene) and anti-HLA A antibody EP1395Y (rabbit monoclonal ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary and secondary antibodies were used at the following concentrations: anti-dendra2 1:5000 (OriGene: TA150090), anti-Slack 1:5000 (Aves labs ...
-
bioRxiv - Cancer Biology 2021Quote: ... and CDK6 proteins (Origene; 0.2 μg), respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... or control recombinant protein CENPA (Origene) at 0.5 ug/ml ...