Labshake search
Citations for Origene Technologies :
151 - 200 of 521 citations for Myc Box Dependent Interacting Protein 1 BIN1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The pLenti-C-Myc-DDK-P2A-BSD and pCMV6-Entry-YTHDF2 were purchased from Origene. The specific variants were generated by site-directed mutagenesis in pCMV6-Entry-YTHDF2 using the QuikChange II site-directed mutagenesis kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used: YFP Goat polyclonal antibody (1:500) (ORIGENE, Cat.No. AB1166-100), mouse mCherry antibody (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... with primary antibodies against Trim39 (Origene, 1:400) and NFATc3 (Proteintech ...
-
bioRxiv - Biochemistry 2022Quote: ... Primary antibodies (PANK1 CST 1:1000; PANK2 Origene 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... CRHR2 antibody (1:1000, ORIGENE, rabbit, AP17244PU-N), Grin2B antibody (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... and rabbit anti-mKate2 antibodies (1:2000, Origene). The protein bands were obtained using horseradish peroxidase-conjugated antibodies against mouse whole immunoglobulins and horseradish peroxidase-conjugated antibodies against rabbit whole immunoglobulins (1∶10,000 ...
-
bioRxiv - Molecular Biology 2020Quote: Full-length cDNA constructs for NSUN6 in the pCMV6-Entry-Myc vector were obtained from OriGene. Site-directed mutagenesis to generate the miCLIP-mutants was performed using the QuikChange II Site-Directed Mutagenesis Kit from Agilent as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: The vector expressing myc-DDK-tagged-human wt DDX6 was purchased from OriGene (RC209431, Rockville, MD). The helicase-deficient DDX6 E247A mutant was constructed by overlapping PCR using primers oVM506 5’-ACTTATCTGCCGCATCCAATACTATCATCTGGACATGAT-3’ and oVM507 5’-TTGGATGCGGCAGATAAGTTGCTGTCACAGGATTTTGTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: A mouse Nup210 full length cDNA (NM_018815) encoding vector (pCMV6-Nup210-Myc) was purchased from Origene Technologies ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser126 to Arg in GPT and Ser153 to ARg in GPT2 was performed with the Q5 site-directed mutagenesis kit frm NEB (#E0554).
-
bioRxiv - Cell Biology 2021Quote: Cells were transiently transfected with a human KLK10-encoding plasmid (pCMV6-KLK10-Myc-DDK; Origene RC201139) at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... Germany 64) and 1.5 µg or 2.0 µg pCMV6-Myc-FLAG-GINS1 (OriGene Technologies, Inc., USA), respectively ...
-
bioRxiv - Genetics 2020Quote: ... ACE2 with C-terminal GFP-tag (RG208442) and Myc-DDK tag (RC208442) were purchased from Origene. Empty vectors pMax-GFP (Lonza ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554) ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression plasmid containing Myc-DDK-tagged NDUFA11 cDNA was purchased from Origene (Origene, cat. no. RC208966) and pRK5-EGFP-MAPT was a gift from Karen Ashe (Addgene plasmid # 46904 ...
-
bioRxiv - Physiology 2021Quote: ... with a myc-FLAG epitope tag on the C-terminus (MR223526, Origene Technologies, Rockville, MD, USA). The human full-length BACE1 or BACE2 cDNAs were expressed from the pcDNA3.1/myc-His expression vector (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... TFEB (S142A) was cloned into pLenti-C-Myc-DDK-IRES-Puro Lentiviral Gene Expression Vector (OriGene). HEK293T cells were transfected using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: The full-length ITFG1 with or without a C-terminal Myc tag (OriGene Technologies, Inc., RC204773) was cloned in the expression vector pcDNA3.3 or pRRL.sin.cPPT.SFFV/IRES-neo.WPRE ...
-
bioRxiv - Biochemistry 2023Quote: ... we obtained the WT mS29 gene as a Myc/DDK-tagged ORF from Origene (Cat# RC223182). Using restriction sites AsiSI and PmeI ...
-
bioRxiv - Cancer Biology 2020Quote: A C-terminal Myc-DKK-tagged RNF43 ORF expression construct was purchased from Origene (Origene, Cat# RC214013) and verified by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 CIC OE cells were developed using CIC-Myc-tag plasmid purchased from Origene (CAT#: RC215209). Geneticin (250μg/ml ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pCMV6-UBE2M-Myc-DDK (DDK is the same as FLAG®) was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Molecular Biology 2019Quote: ... Human SCAND1 (NM_033630) ORF clone with Myc-DDK C-terminal tag (RC200079) was purchased (Origene, Rockville, MD) and designated pCMV6-ScanD1-myc-Flag ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Cell Biology 2021Quote: Myc-DDK tagged Mnr (4933427D14Rik) cDNA in cloned in a pCMV6 plasmid was obtained from Origene (MR211309). hTERT-RPE1 cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio ...
-
bioRxiv - Microbiology 2022Quote: ... and p62 T269E/S272D-3x Flag were cloned into pLenti-C-Myc-DDK-IRES-Neo vector (Origene) using NEBuilder® HiFi DNA Assembly Master Mix per manufacturer’s instructions (New England BioLabs ...
-
bioRxiv - Pathology 2022Quote: ... or control empty plasmids (pLJM1-EGFP, Addgene 19319 and pLenti-C-Myc-DDK-P2A-Puro, Origene PS100092) using Lipofectamine 3000 and cultured for 48 h ...
-
bioRxiv - Cell Biology 2023Quote: A Myc-DDK (FLAG)-tagged coding DNA sequence (CDS) clone of murine Runx2 was purchased from Origene within the pCMV-ENTRY overexpression vector (catalogue number MR227321) ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (Origene, #225495) using a Q5® Site-Directed Mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Biophysics 2023Quote: A Myc/DDK eptiope-tagged Pin1 (NM_006221) Human Tagged ORF Clone (Cat# RC202543) was obtained from OriGene Technologies Inc ...
-
bioRxiv - Immunology 2023Quote: The plasmid expressing myc-DDK-tagged wild-type ADA2 (transcript variant 3, NM_001282225) was purchased from OriGene Technologies (#RC238645) ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Molecular Biology 2020Quote: The mouse YAP1 WT gene with a Myc-tag in the pCMV6 backbone was purchased from Origene (MR226049). YAP S274A and YAP S352A mutants were generated by PCR assembly ...
-
bioRxiv - Immunology 2020Quote: ... 0.1ug of sequence-verified pCMV-insert-MYC-FLAG overexpression vectors containing either no insert (Origene #PS100001; ‘mock’ transfection) or RFX6 insert (Origene #RC206174 ...
-
bioRxiv - Cell Biology 2022Quote: ... Human ACLY(H760A) was generated by site-directed mutagenesis using the pCMV6-ACLY(MYC-FLAG) vector (Origene, RC200508). Human CPα (CAPZA1 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GAPDH antibody (TA802519) is from Origene (WB-1:5000), anti-HA antibody (C29F4 ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies used were hnRNPM (Origene technologies, TA301557, 1:50,000), GAPDH (EMD Millipore ...
-
bioRxiv - Biochemistry 2024Quote: ... and mouse α-PUS7 monoclonal antibody (OriGene, OTI4C6; 1:1,000) followed by goat α-rabbit ...
-
bioRxiv - Cell Biology 2024Quote: ... and mouse anti-BTN3A2 antibodies (ORIGENE, USA, #CF500730, 1:50), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... 293T cells were co-trasfected with 1μg per well of 6-well plate of either pCAGGS/GST or pCAGGS/GSTVPS28 and with with 1μg per well of 6-well plate of pCMV6-Entry-AKTIP-Myc-Flag (ORIGENE) or with 1μg per well of 6-well plate of AKTIP-HA (pCR3.1 ...
-
bioRxiv - Microbiology 2019Quote: ... The lentiviral expression plasmid pLenti-C-Myc-DDK harboring the human vimentin gene (NM_003380, pLenti-VIM) was obtained from Origene. To generate lentiviruses ...
-
bioRxiv - Genetics 2021Quote: ... When cells reached ∼80% confluency cells were transiently transfected with NDUFAF1(NM_016013) C-Myc/DDK-tagged plasmid (Origene #RC200029) with Lipofectamine 3000 (Thermo #L3000001 ...
-
bioRxiv - Physiology 2020Quote: ... A pCMV6-myc-DDK-Fbxl22 full-length cDNA (GenBank Accession Number: NM_175206) plasmid was purchased from Origene (Rockville, MD). The full-length Fbxl22 variant was termed Fbxl22-236 in this study ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... the coding sequence without stop codon was amplified by PCR from the Myc-DDK-tagged CDK5RAP3 (tv3) plasmid (Origene Technologies ...
-
bioRxiv - Neuroscience 2023Quote: Expression vectors of Myc-DDK-tagged human ORF clones of ANKS1B and SYNGAP1 were purchased from Origene (#RC211877, #RC229432). V5-epitope or GFP-tagged mutants were cloned into the same expression backbone ...
-
bioRxiv - Developmental Biology 2022Quote: Lenti-X 293T cells were transiently transfected with a CITED2 (NM_001168388) human c-Myc and DYKDDDDK (DDK) tagged open reading frame clone (RC229801, Origene) using Attractene in DMEM medium supplemented with 100 U/ml penicillin ...
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: ... The ensuing amplicon was ligated into the EcoRV and PmeI restriction sites of pCMV-mATXN2-Myc-PolyA (MR218010, OriGene) by Gibson assembly using the Gibson Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Physiology 2023Quote: Mammalian expression plasmid encoding human TMEM263 with a C-terminal epitope tag (Myc-DDK) was obtained from Origene (RC203933). Control pCDNA3.1 empty plasmid was obtained from Invitrogen ...