Labshake search
Citations for Origene Technologies :
51 - 100 of 398 citations for Mouse Anti Dengue Virus NS1 Serotype 3 Antibody CC6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... anti-Klf5 antibody (1:100, TA811868, Origene), anti-Bmp7 antibody (1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal antibody against IL-1β (Origene Inc., Cat# TA506443, 1:1000), rabbit polyclonal antibody against p65 (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse mAb anti-6xHis tag (clone HIS.H8) was from OriGene Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lactating mammary gland protein butyrophilin (BTN1A1) anti-BTN1A1 (mouse, OriGene Technologies ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene, #TA150041); for western blot ...
-
bioRxiv - Neuroscience 2022Quote: ... LILRB5 and OTOR carried out using virus particles obtained from OriGene (Rockville, MD). Virus transduction were carried out at 5.0 MOI using polybrene ...
-
bioRxiv - Cancer Biology 2021Quote: ... the anti-MYC antibody 9E10 was from Origene, the anti-Strep-tag antibody from Biorad ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-ALPPL2 affinity-purified rabbit polyclonal antibody (Origene) or anti-ALPPL2 mouse antibody (Clone SPM593 ...
-
bioRxiv - Biochemistry 2023Quote: ... and rabbit anti-mKate2 antibodies (1:2000, Origene). The protein bands were obtained using horseradish peroxidase-conjugated antibodies against mouse whole immunoglobulins and horseradish peroxidase-conjugated antibodies against rabbit whole immunoglobulins (1∶10,000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... was purchased from Sigma Aldrich and mouse anti-PDLIM2 Ab (1:250) was purchased from Origene. Rabbit anti-FAK Abs (1:500) ...
-
bioRxiv - Immunology 2022Quote: ... The membrane was probed with anti-ZFP36 mouse monoclonal (Origene #OTI3D10) (2 μg/ml ...
-
bioRxiv - Microbiology 2020Quote: The antibodies used in the study include: polyclonal rabbit anti-RBBP6 antibody (Origene Technologies, TA309830), polyclonal rabbit anti-hnRNPL (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit polyclonal anti-CCL5 antibody (Origene Cat# PP1081P1, RRID:AB_1006884) was used for the neutralization of CCL5 chemokine.
-
bioRxiv - Biochemistry 2022Quote: ... and the other with anti-METTL7A primary antibody (Origene, Rockville MD ...
-
bioRxiv - Molecular Biology 2019Quote: ... The antibodies used include: anti-turboGFP (Origene, cat # TA150041), -PDHA1 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GAPDH (2D9) and a rabbitt polyclonal anti-CEACAM1 (TA350817) antibody were from Origene. Anti-Rabbit-HRP and anti-mouse-HRP were from Cell Signalling Technologies ...
-
bioRxiv - Neuroscience 2020Quote: B2M was knocked down using lentiviral particles containing B2M-targeting shRNA (OriGene, TL314543V, Virus A). Non-targeting scramble shRNA from the same kit was used as control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse monoclonal anti-ZsGreen1 (ZSG) clone TI2C2 (1:2000) (OriGene, Cat#: TA180002); Mouse anti-capsid (1:3000 ...
-
bioRxiv - Immunology 2023Quote: ... and mouse anti-GAPDH monoclonal IgG (Origene TA802519, clone OTI2D9, 1:2000). Secondary antibodies were donkey anti-rabbit IgG (Alexa Fluor 790 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies against SC2 included rabbit anti-Nucleoprotein MAb (Origene) and rabbit anti-Spike MAb (Origene) ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-Rab IgG secondary rabbit antibody (OriGene Technologies, U.S.) were diluted at 1:5000 for incubation with the membrane ...
-
bioRxiv - Immunology 2020Quote: ... and rabbit anti-CCR7 polyclonal antibody (TA310252, Origene, Rockville, MD). The secondary antibodies were FITC- ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GAPDH antibody (TA802519) is from Origene (WB-1:5000), anti-HA antibody (C29F4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mouse anti-ZEB2 (Origene, TA802113, IF 1:150, WB 1:2000 in milk), sheep anti-TBR2 (R&D Systems ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-LGR5 mouse monoclonal conjugated with PE at 1:100 (Origene #TA400001). Apart from the LGR5 antibody incubation (of 20 minutes) ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the membrane was incubated overnight at 4°C with primary antibody solution (1:1000 dilution for anti-TSG101 [Abcam, ab30871], anti-Calnexin [ThermoFisher, PA5-19169] and anti-Syntenin-1 [Origene, TA504796] ...
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Microbiology 2020Quote: ... HSV-2 (55aa, YP_009137225.1), and B-virus (56aa, NP_851932) were synthesized and cloned in pCMV6-Entry vector by Origene custom service ...
-
bioRxiv - Microbiology 2021Quote: ... a rabbit anti-C.a polyclonal antibody at 25 µg/mL (OriGene) counterstained with a secondary goat anti-rabbit IgG conjugated with Alexa Fluor 555 at 0.4 µg/mL (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Developmental Biology 2021Quote: ... The primary antibodies used were: rabbit anti-GFP (1:500; Origene TP401), mouse anti-GFP (1:500 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The primary antibody anti-DDK (FLAG®) (OriGene Technologies, TA50011, 1:1000) was used for detection of proteins overexpressed from the pCMV6-entry vector ...
-
bioRxiv - Genetics 2020Quote: ... cells were fixed and stained with an anti-DDK antibody (OriGene, TA50011), and actin and dapi probes as described for immunofluorescence above ...
-
bioRxiv - Cell Biology 2021Quote: ... the antibodies used were rabbit monoclonal anti-GLI1 (Clone EPR4523, Origene Technologies) at a 1:1000 dilution and anti-Lamin A/C (Cell Signaling Technologies 2032 ...
-
bioRxiv - Biochemistry 2022Quote: ... and Rabbit Polyclonal Anti-METTL7A Antibody was obtained from Origene (Rockville, MD). Reagents and materials for cell culture and gene modulation ...
-
bioRxiv - Neuroscience 2023Quote: ... was then used with an anti-FKBP5 antibody (OriGene, Rockville, MD, USA) at a 1 in 80 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... two different anti-human DSG2 antibodies (DSG2-Origene, #BM5016; DSG2-Abcam, #ab14415) were used at 1:1000 dilutions in blocking buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... or a dilution of 1/1,000 anti-turboGFP chicken antibody (Origene; TA150075) respectively ...
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.