Labshake search
Citations for Origene Technologies :
1 - 50 of 398 citations for Mouse Anti Dengue Virus NS1 Serotype 3 Antibody CC6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal anti-DDK antibodies from Origene; mouse monoclonal anti-myogenin antibodies from BD Biosciences ...
-
bioRxiv - Neuroscience 2024Quote: ... with mouse monoclonal anti-FLAG antibody (anti-DDK; 1:1,000, OriGene) in blocking solution for 2–3 days ...
-
bioRxiv - Cell Biology 2024Quote: ... and mouse anti-BTN3A2 antibodies (ORIGENE, USA, #CF500730, 1:50), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: Sandwich ELISA was performed with mouse anti-NDV-HN antibodies (OriGene) diluted 1:100 in PBS for 1 h to capture whole attenuated NDV (VH ...
-
bioRxiv - Neuroscience 2023Quote: ... Each virus expressed the full-length sequence for either mouse Elp1 (Origene MC202501, NM 026079) or human ELP1 (Origene RC2076868) ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
Mck1 defines a key S-phase checkpoint effector in response to various degrees of replication threatsbioRxiv - Molecular Biology 2019Quote: ... Hug1-13MYC protein levels were detected with mouse anti-MYC antibody (1:1000, ORIGENE) and HRP-conjugated anti-mouse IgG as the secondary antibody (1:10000 ...
-
bioRxiv - Cell Biology 2020Quote: ... the samples were immunostained with the anti-IRSp53/BAIAP2 antibody 1D9 (mouse monoclonal, 1:200, OriGene) and anti-HLA A antibody EP1395Y (rabbit monoclonal ...
-
A novel neural stem cell-derived immunocompetent mouse model of glioblastoma for preclinical studiesbioRxiv - Cancer Biology 2020Quote: ... mouse anti Bcat1 (TA504360, OriGene), mouse anti-GFAP (644701 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Turbo GFP (mouse; Origene).
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-MIC19 (TA803454, Origene) at 1:1,000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-TurboGFP (TA150041, Origene), mouse anti-FLAG M2 (F1804 ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A) mouse monoclonal antibody (Origene) and MUC5AC monoclonal antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-CC10 (Origene, AM26360PU-N), Mouse-anti-CD63 (DSHB Hybridoma Product H5C6 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-KRas antibody (OriGene, mouse monoclonal #CF801672 ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was then incubated overnight at 4°C with a mouse monoclonal anti-mCherry antibody (Origene; 1:1500) diluted in 5% milk in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody against Trim39 was from Origene (#TA505761). Rabbit polyclonal antibody against Trim39 was from Proteintech (#12757-1-AP) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1:100 mouse anti-β-catenin (Origene), 1:100 mouse anti-E-cadherin (Cell Signaling) ...
-
bioRxiv - Genomics 2021Quote: ... mouse anti-TurboGFP (1:250, Origene, TA150041) / rabbit anti-Flag (1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... *Mouse anti-DsRd (1:500, TA180084, Origene), *Rabbit anti-DsRd (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-Flag (Origene, TA50011, 1:1,000), goat anti-Flag (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-Flag (Origene, TA50011, 1:1,000), goat anti-ChAT (Chemicon ...
-
bioRxiv - Immunology 2023Quote: ... Mouse anti ZFP36 (Origene #OTI3D10, 2μg/ml), rabbit anti ZFP36L1 (CST #BRF1/2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... *Mouse anti-DsRd (1:500, TA180084, Origene), *Rabbit anti-DsRd (1:500 ...
-
bioRxiv - Bioengineering 2024Quote: ... mouse anti-Lhx1 (CF504527, OriGene, RRID: AB_2724601) labeled with Alexa Fluorphore 647 (Novus ...
-
bioRxiv - Immunology 2019Quote: ... 1 mg of whole-cell extracts (200 μl) were incubated overnight with 1 μg of an anti-flag mouse monoclonal antibody (Origene) at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Microbiology 2020Quote: ... anti-TRAF6 or anti-MEKK3 antibodies (all from Origene). A rabbit monoclonal anti-BST-2 antibody (Abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... the slides were washed three times with PBS and incubated with secondary antibodies (hypersensitive enzyme-labeled goat anti-mouse/rabbit IgG polymer (OriGene, China) at room temperature for 20 min ...
-
bioRxiv - Biochemistry 2024Quote: ... and mouse α-PUS7 monoclonal antibody (OriGene, OTI4C6; 1:1,000) followed by goat α-rabbit ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-DDK (4C5) (OriGene Technologies, Rockville, MD). Alexa-594 labeled transferrin ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-ERGIC-53 (clone 2B10, OriGene), rabbit polyclonal anti-ERGIC-53 (E1031 ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-DDK-Flag tag (Origene, 1:2000); rabbit anti-pS/TQ (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Cell Biology 2021Quote: ... virus particle containing supernatant was collected and enriched using LentiConcentrator (OriGene). Cells were transduced with the respective concentrated virus particles using 10 µg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... virus-containing supernatant was collected and concentrated using Lenti-Concentrator (OriGene), for minimum 2h at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Cell Biology 2023Quote: ... DSG2 and DSG3-Fc proteins and N-CAD-Fc protein were detected with the following antibodies: mouse-anti-DSG2 (#BM5016, Origene, 1:200); mouse-anti-DSG3 5G11 (#32-6300 ...
-
bioRxiv - Biochemistry 2024Quote: ... CDK2 mouse monoclonal antibody (HRP conjugated) [Clone ID: OTI2D9] (Origene, TA502935BM), monoclonal Anti-FLAG M2-peroxidase (HRP ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-desmoglein-2 mouse monoclonal (Origene, Rockville, MD, USA), anti-E-cadherin mouse monoclonal (BD ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse anti-Myc-tag (9E10) was purchased from Origene; Rabbit anti-GM130 was purchased from Abcam ...
-
bioRxiv - Immunology 2020Quote: ... Mouse anti-Myc (9E10) Ab was from Origene (USA); Rabbit anti-GM130 was from Abcam (United Kingdom) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-Znt3 mouse mAb (#TA501498, Origene Technologies, Rockville, MD), and anti-Znt4 rabbit pAb (#PA5-80028 ...
-
bioRxiv - Cell Biology 2023Quote: ... Mouse monoclonal anti-BAG5 (CF810618) was purchased from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-LGR5 mouse mAb (TA503316S, Origene, Rockville, MD, USA), anti- Keratin20 Rabbit mAb (#13063 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Cancer Biology 2019Quote: ... For immunoblotting anti-DDK antibody (Origene TA50011) or (Ab2 ...