Labshake search
Citations for Origene Technologies :
401 - 450 of 650 citations for Human Fibrinogen C Domain Containing Protein 1 FIBCD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Neuroscience 2021Quote: ... 200.000 cells were resuspended in the nucleofection solution containing 800 ng plasmid DNA (SC118279, Origene, or eGFP in pcDNA3.1) and analysed after 72 h.
-
bioRxiv - Physiology 2021Quote: ... and with 300 ng of cDNA plasmid encoding wild-type or mutant human TRPA1 (pCMV6-XL4 vector, OriGene Technologies, Rockville, MD, USA). The cells were used 24–48 h after transfection ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Microbiology 2020Quote: ... Stably transduced THF expressing human Flt-3R were generated by transduction with the lentivirus pLenti-FLT3-mGFP-P2A-Puro (OriGene Technologies RC211459L4V) followed by GFP purification after one week of Puro (800 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Cell Biology 2022Quote: 70% confluent HEK293T cells were transfected with Flag-tagged Mena in pcDNA3.1+/C-(K)DYK (obtained from Origene; Omu14068c) using calcium phosphate-based transfection ...
-
bioRxiv - Genetics 2021Quote: ... When cells reached ∼80% confluency cells were transiently transfected with NDUFAF1(NM_016013) C-Myc/DDK-tagged plasmid (Origene #RC200029) with Lipofectamine 3000 (Thermo #L3000001 ...
-
bioRxiv - Neuroscience 2021Quote: pCMV-ONCM was constructed by cloning ONCM cDNA as BamHI/NotI fragment from My c-DDK-tagged oncomodulin (OriGene) in a mammalian expression vector pCMV (Addgene) ...
-
bioRxiv - Cell Biology 2023Quote: ... Stable TFEB knockdown was achieved by transfecting TFEB-specific shRNA cloned in pRFP-C-RS plasmid (OriGene RNAi, 0513). The same plasmid containing non-specific shRNA was used as a control (OriGene RNAi ...
-
bioRxiv - Biophysics 2023Quote: HEK cells were transfected with plasmid encoding the +SS4 isoform of N1β with a C-terminal tGFP tag (Origene) (HEK-N1β ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a human GAB1 3′-UTR reporter plasmid (containing 3770 bp immediately downstream of the end of the GAB1 ORF cloned into pMirTarget, Origene), a control Renilla luciferase plasmid (Promega ...
-
bioRxiv - Immunology 2021Quote: The pCMV6-Ac-GFP vector containing the mouse Mt3 gene (pCMV6-Ac-MT3-GFP) and empty pCMV6-Ac-GFP vectors were acquired from Origene and dissolved in nuclease-free sterile H2O ...
-
bioRxiv - Cancer Biology 2019Quote: Overexpression of LPL was performed using a human LPL clone in pCMV-6AC plasmid vector synthesized by OriGene (Rockville, MD; Cat. No. SC322258). An empty pCMV-6AC (“pCMV Neo” ...
-
bioRxiv - Microbiology 2020Quote: ... pRS-derived retroviral vectors expressing a scramble shRNA and shRNA targeting the mRNA of human LY6E were obtained from OriGene (Cat. No. TR311641).
-
bioRxiv - Molecular Biology 2022Quote: ... HC-04 cell line CYP 2D6 RNA levels were compared against commercially available human liver tissue CYP 2D6 RNA levels (OriGene Technologies, Rockville, MD). RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: ... we purchased wild-type mammalian expression plasmids with C-terminal FLAG tag were purchased from Origene (Origene Technologies Inc., RC209752). The RNF114 C8A mutant was generated with Q5 site-directed mutagenesis kit according to manufacturer’s instructions (New England Biolabs ...
-
bioRxiv - Cell Biology 2019Quote: ... and shRNAs against mouse DNMBP cloned into the pRFP-C-RS vector (TF515449, Locus ID 71972) were purchased from OriGene. Cdc42F28L-HA was provided by Richard A ...
-
bioRxiv - Developmental Biology 2019Quote: ... Short RNA hairpin (sh-RNA)-based expression vectors for RNA interference pRFP-C-RS (FZD10 shRNAs and scrambled shRNA) were purchased from Origene. The three sequences were ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid containing source cDNA sequence for Mus musculus MIM (NM_144800) with C-terminal myc- and FLAG-tag was purchased from Origene (MR210506). All plasmids were sequenced to confirm the correct coding sequence (Eton Bioscience).
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Blots were blocked for 1 hour at room temperature with 2% BSA diluted in PBST and incubated overnight at 4 °C with 25 μg/ml of PLG (Origene) diluted in blocking solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... wells were blocked with 1% BSA diluted in PBS for 30 min at 37 °C and increasing amounts (0 μg to 3 μg) of PLG (Origene) diluted in blocking solution were added to the wells and incubated for 1 hour at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were generated by transfection of HEK 293 cells with the respective plasmid and pLenti-C-mGFP-P2A-Puro Lentiviral Gene Expression Vector (Cat. #PS100093, Origene). Lipofectamine 2000 (Cat.# 11668030 ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Cancer Biology 2023Quote: ... The OC2 overexpression construct was generated by cloning the full-length OC2 cDNA (NM_004852) into the pLenti-C-Myc-DDK-IRES-Puro (Origene #PS10069) lenti-virus system ...
-
bioRxiv - Neuroscience 2024Quote: ... U251-MG cells were stably transfected with a GFP-tagged YTHDF2 expression plasmid pLenti-C-mGFP-P2A-Puro (OriGene, #RC230306L4) or GFP empty vector by lipofectamine 2000 according to the procedure recommended by the manufacturer ...
-
bioRxiv - Neuroscience 2024Quote: ... Louis, MO) (96, the C-terminal HA-tagged ERα was constructed from the purchased ERα cDNA expression clone (Origene #MG227304) into BamHI and EcoRI sites of pcDNA3 vector using PCR amplification ...
-
bioRxiv - Neuroscience 2022Quote: 1μL (1667fmol) 13C615N4-L-Arginine13C615N2-L-Lysine Stable Isotope Labeled (SIL) β4 protein standard (Origene #PH310440) was added to each sample (total=16 samples overall ...
-
bioRxiv - Physiology 2021Quote: ... the pRL-TK renilla luciferase vector as an internal control and varying concentration of a CASR containing a myc tag vector (Origene Inc.). After 24 hr incubation with standard medium containing 1.5 mM calcium the cells were assayed for Cldn14 reporter expression using a luciferase assay system from Pormega Corp ...
-
bioRxiv - Developmental Biology 2022Quote: ... for testing were co-transfected with Renilla control plasmid (20 ng) and either a plasmid containing mouse Tbx1 cDNA (200 ng, Origene, PS100001) or empty vector control (200ng ...
-
bioRxiv - Cancer Biology 2020Quote: The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase):
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Physiology 2021Quote: ... GGC CCG ATT GCT TCG AGA A (Nrf1) and pRFP-C-RS scrambled shRNA plasmid vectors were obtained from OriGene (TR30015). For analgesia ...
-
bioRxiv - Neuroscience 2022Quote: Stable knockdown of Cebpg in 50B11 cells was done by transfecting 50B11 cells with pGFP-C-shLenti carrying shRNA against Cebpg (1µg/ml; TL709448; Origene, Rockville, MD) following manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2021Quote: Cxcl5 (NM_009141) Mouse Tagged ORF Clone Lentiviral Particles containing 107 transduction units/ml were purchased from Origene (Cat no: MR200761L4V; Rockville, MD). 50 μl of lentiviral suspension was added to sub-confluent KRC line in a single well of a 24-well plate containing 200 μl of complete media ...
-
bioRxiv - Neuroscience 2023Quote: ... we used plasmids containing scrambled shRNA and anti-SNX27 shRNA under the CMV promoter (pCMV-scr-shRNA, pCMV-shSNX27, Origene Technologies #TL518223). All plasmid DNA were purified using the ZymoPure II (Zymo Research ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviruses were produced by transfecting HEK293T/17 cells with the pLenti-C-mGFP vector where SCXB has been inserted (OriGene, Rockville, MD) expressing Scx-GFP and two packaging plasmids33 (pCMV-dR8.2 ...
-
bioRxiv - Microbiology 2021Quote: ... A549-expressing human ACE2 (A549ACE2) cells were generated by transducing A549 cells with the ACE2-expressing lentiviral vector (pLenti-C-mGFP-ACE2) (Origene, Cat# PS100093) and then selected with puromycin according to the manufacturer’s procedure.
-
bioRxiv - Cell Biology 2023Quote: ... The OGT lentiviral vector was produced by first cloning OGT with C-terminal FLAG and HA tags into the pCMV6 entry vector (Origene, Rockville, MD) using the NEBuilder HiFi DNA assembly and Q5 site-directed mutagenesis kits according to the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... sharing 91% homology with mouse JPH2 protein) and mouse Jcn cDNA (Accession number: NM_133723, Origene, Rockville, MD, USA) were inserted into pVN155 and pVC155 ...
-
bioRxiv - Genomics 2024Quote: ... cells were transfected with 300 ng of each sgRNA-15xPBS plasmid and 40 ng of each fluorescent protein plasmid using 3.5 µL TurboFectin 8.0 (OriGene). Media was changed at 24 hours post-transfection.
-
bioRxiv - Genetics 2019Quote: A CrispR-Cas9 knockout kit (Origene, Rockville, MD) for mouse Kif26b (SKU KN308785) ...
-
bioRxiv - Pathology 2023Quote: Human astrocytes used co-culture were first transduced with lentiviruses carrying GFP (LentiORF control particles of pLenti-C-mGFP-P2A-Puro Origene™ cat# PS100093V), CLU (Lenti ORF particles ...