Labshake search
Citations for Origene Technologies :
351 - 400 of 650 citations for Human Fibrinogen C Domain Containing Protein 1 FIBCD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Amplicons were ligated into AscI and NotI digested pLENTI-C-mGFP (#PS100071, OriGene, Rockville, MD, USA) according to standard procedures ...
-
bioRxiv - Genetics 2020Quote: ... ACE2 with C-terminal GFP-tag (RG208442) and Myc-DDK tag (RC208442) were purchased from Origene. Empty vectors pMax-GFP (Lonza ...
-
bioRxiv - Physiology 2021Quote: ... with a myc-FLAG epitope tag on the C-terminus (MR223526, Origene Technologies, Rockville, MD, USA). The human full-length BACE1 or BACE2 cDNAs were expressed from the pcDNA3.1/myc-His expression vector (Invitrogen ...
-
Proteasomal degradation of human SERINC4: a potent host anti-HIV-1 factor that is antagonized by NefbioRxiv - Microbiology 2020Quote: ... and Ser5 and murine Ser4 that express a C-terminal FLAG tag were purchased from Origene, and the Ser1 ...
-
bioRxiv - Developmental Biology 2023Quote: The full-length ITFG1 with or without a C-terminal Myc tag (OriGene Technologies, Inc., RC204773) was cloned in the expression vector pcDNA3.3 or pRRL.sin.cPPT.SFFV/IRES-neo.WPRE ...
-
bioRxiv - Cancer Biology 2023Quote: ... TFEB (S142A) was cloned into pLenti-C-Myc-DDK-IRES-Puro Lentiviral Gene Expression Vector (OriGene). HEK293T cells were transfected using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... NM_018718.3) cloned in pcDNA3.1 vector with a C-terminal eGFP tag was procured from Origene (USA). The CEP41 cDNA was amplified and subcloned into a bacterial expression vector pET28a(+ ...
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...
-
bioRxiv - Cancer Biology 2020Quote: ... 22Rv1 SLFN5 KO cells were further transfected with SLC7A5 (NM_003486) Human Tagged ORF Clone (RC207604, Origene, Rockville, MD, USA). Cells were then clonally selected ...
-
bioRxiv - Cell Biology 2021Quote: ... NPC1 human fibroblasts were transfected with either eGFP-Vector (pCMV6-AC-GFP Tagged Cloning Vector, Cat #PS100010, Origene Technologies) or eGFP-HSP40 (DNAJB11 (NM_016306 ...
-
bioRxiv - Cell Biology 2022Quote: ... The human FLAG-tagged EMC5 plasmid (catalog #: RC207046) and FLAG-tagged EMC6 plasmid (catalog #: RC215548) were obtained from Origene. The mutations EMC3-R31A ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293-Klotho cells were seeded at density of 500 000 cells/well on 6-well tissue culture plates and transfected with RhoGDI1 (ARHGDIA) (NM_004309) Human Tagged ORF Clone (RG200902 OriGene) using Lipofectamine 3000 Transfection Reagent (L3000015 Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fifty FhNEJ per condition were washed 3 times in PBS and incubated with blocking solution (0.1% BSA in PBS) supplemented with 100 μg/ml of human PLG (Origene) for three hours at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: Expression vectors of Myc-DDK-tagged human ORF clones of ANKS1B and SYNGAP1 were purchased from Origene (#RC211877, #RC229432). V5-epitope or GFP-tagged mutants were cloned into the same expression backbone ...
-
bioRxiv - Bioengineering 2024Quote: Human cryosections from the aorta of a 76-year-old male with atherosclerosis were purchased from OriGene (CAT#: CS611744). Sections were stained as above with minor alterations ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2018) E-cadherin deficient PDAC021T were transfected with human E-Cadherin mGFP-tagged Tagged ORF Clone Lentiviral Particle (Origene) at 25 multiplicity of infection (MOI) ...
-
bioRxiv - Cell Biology 2022Quote: ... Culture media containing lentivirus were collected 48-72h post transfection and concentrated using lentivirus concentration solution (Origene) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were incubated with media containing Lipofectamine reagents and either a METTL7A (Origene, Rockville MD, Ref: RC202601), METTL7B (Origene ...
-
bioRxiv - Neuroscience 2023Quote: ... we used a plasmid containing SNX27-FLAG under CMV promoter (pCMV-SNX27-FLAG, OriGene Technologies plasmid #MR218832). For SNX27 knockdown experiments ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant Myc-Flag-RNF114 proteins were purchased from Origene (Origene Technologies Inc., TP309752) or were purified as described previously(Spradlin et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: A C-terminal Myc-DKK-tagged RNF43 ORF expression construct was purchased from Origene (Origene, Cat# RC214013) and verified by Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... primary antibody was applied overnight at 4 °C including antibodies against β-catenin (cat# AB0095-200, OriGene), β-Actin (cat# 4967 ...
-
bioRxiv - Pathology 2019Quote: ... N- and C-fragment were cloned into a lentiviral expression plasmid (Cat. No: PS100101, OriGene, Rockville, MD). For generating CRIPSR KO podocytes ...
-
bioRxiv - Microbiology 2022Quote: ... and p62 T269E/S272D-3x Flag were cloned into pLenti-C-Myc-DDK-IRES-Neo vector (Origene) using NEBuilder® HiFi DNA Assembly Master Mix per manufacturer’s instructions (New England BioLabs ...
-
bioRxiv - Pathology 2022Quote: ... or control empty plasmids (pLJM1-EGFP, Addgene 19319 and pLenti-C-Myc-DDK-P2A-Puro, Origene PS100092) using Lipofectamine 3000 and cultured for 48 h ...
-
bioRxiv - Cell Biology 2023Quote: ... [TL51074CB 5’ –AGACCGTAAACGCTATCAGCAAGAAGTAG] are in the plasmid backbone pGFP-C-shLenti and were from Origene (Rockville, MD). The non-targeting shRNA control ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-null2 cells were transfected with a human TLR4 expression clone (pcDNA3-TLR4-YFP was a gift from Doug Golenbock – http://n2t.net/addgene:13018) and human MD-2 expression clone (Origene; RC204686) to assess cytokine secretion in response to TLR4 agonist treatments ...
-
bioRxiv - Genetics 2019Quote: The human wild-type ARSA cDNA (cloned in the pCMV6 plasmid) was purchased from Origene (Cat. No. RC204319, Origene, USA). The c.925G mutations (c.925G>A ...
-
bioRxiv - Physiology 2022Quote: ... IL); cDNA coding human NACHO (TMEM35A; accession number: Q53FP2; (Gu et al., 2016)) in pCMV6-XL5 was purchased from OriGene Technologies Inc ...
-
bioRxiv - Biochemistry 2021Quote: Small interfering RNA (siRNA) oligo duplexes of 27 bases in length for human PNPLA2 were purchased from OriGene (Rockville, MD). Their sequences ...
-
bioRxiv - Cell Biology 2022Quote: ... HESCs were transfected with an empty expression plasmid (control) or human KISS1R expression plasmid corresponding to the open reading frame (Origene) or human ESR1 expression plasmids hESR1-46 or hESR1-66 (Flouriot ...
-
bioRxiv - Cell Biology 2023Quote: ... transient or tetracyclin-inducible expression of human HEATR5B with an N-terminal GFP tag in human cells) were cloned by Gibson assembly with the full-length human HEATR5B open reading frame (derived from plasmid RC22610 (Origene)) and either pcDNA3.1-eGFP-linker or pcDNA5-FRT/TO-eGFP-linker plasmids (coding for eGFP and a GGSGGSGG linker ...
-
bioRxiv - Cell Biology 2023Quote: ... PRB-114P) was from Covance. Mouse monoclonal anti-human JC (clone 3C7, aka OTI3C7) (cat. TA504168) was obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2023Quote: A recombinant hCABS1 overexpression lysate (OEL) produced in Human Embryonic Kidney 293T (HEK293T) cells (OriGene Technologies Inc., Rockville, MD, USA) was used as a positive control in WB ...
-
bioRxiv - Molecular Biology 2024Quote: NSC34 and HEK293T cells were transfected with a plasmid coding for the hnRNPA2B1 (NM_002137) Human Tagged ORF Clone (Origene, RC219318) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen L3000001) ...
-
bioRxiv - Genomics 2021Quote: ... containing a single guide RNA target sequence 5’-TAGGTCGCCAAAATCCACAC-3’ or the pCas-Guide CRISPR vector (OriGene, KN519669G2) containing a single guide RNA target sequence 5’-CGAGGCGTTTGACCCACCAG-3’ or a combination of the two was transfected into the mouse submandibular salivary gland cell line SIMS using Thermo Fisher’s Lipofectamine 3000 Reagent kit in the following manner ...
-
bioRxiv - Immunology 2020Quote: ... 0.1ug of sequence-verified pCMV-insert-MYC-FLAG overexpression vectors containing either no insert (Origene #PS100001; ‘mock’ transfection) or RFX6 insert (Origene #RC206174 ...
-
bioRxiv - Molecular Biology 2022Quote: H9c2 cells were transfected with plasmid containing DDK-tagged mouse JCN (Accession number: NM_133723, Origene, Rockville, MD, USA) or its mutant (K8R/K102R/K107R/K140R ...
-
bioRxiv - Immunology 2022Quote: ... The lentivirus containing media was harvested 72 h after transfection and concentrated 80 times using Lenti Concentrator (Origene). LV particles were then resuspended in RPMI 1640 media without serum and stored at −80°C before use ...
-
bioRxiv - Immunology 2023Quote: ... containing 1000 U/mL GM-CSF (Primmune Inc.) and IFN-α (IFN-α 2b, OriGene Technologies or MSD) as previously described (23) ...
-
bioRxiv - Neuroscience 2020Quote: ... 100 μg of lysates or 100 ng of TDP-43 recombinant protein (NM_007375, OriGene) was incubated with 30 pmol of biotin-labelled RNA for 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 0.012 μg of bacterially produced and purified recombinant IMP3 protein (Origene, cat#TP760798) in hypotonic lysis buffer (5 mM Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... Incubation with primary antibodies at 37°C for 1h included goat β-catenin antibody (cat# AB0095) from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Biochemistry 2020Quote: The cDNA encoding full-length human SNED1 (fl-SNED1) cloned into pCMV-XL5 (clone SC315884) was obtained from Origene (Rockville, MD). The cDNA encoding full-length murine Sned1 cloned into pCRL-XL-TOPO (clone 40131189 ...
-
bioRxiv - Genetics 2022Quote: ... For WDR34p.Arg183Trp and WDR34p.Gly394Ser mutants cells were transfected with WDR34 human Myc-DDK-tagged tagged ORF Clone (RC204288, OriGene, Rockville, Maryland, USA) and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536 ...
-
bioRxiv - Physiology 2023Quote: ... containing the CMV promoter in front of the human FHF2-VY cDNA (NCBI Reference Sequence NM_001139500, full-length cDNA clone purchased from Origene, Rockville, MD) silently mutated in the sequence targeted by the FHF2 shRNA ...
-
bioRxiv - Molecular Biology 2023Quote: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691), OCT4 (Origene TP311998) ...
-
bioRxiv - Genetics 2023Quote: ... were suspended in 400 µl of standard culture media lacking penicillin/ streptomycin and either 20 µg of pCMV6-AC-GFP human SOX11 (NM_003108; Origene, Maryland, US) or pCAG-eGFP (Liew et al ...