Labshake search
Citations for Origene Technologies :
351 - 386 of 386 citations for Inhibin beta C chain INHBC Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... we purchased wild-type mammalian expression plasmids with C-terminal FLAG tag were purchased from Origene (Origene Technologies Inc., RC209752). The RNF114 C8A mutant was generated with Q5 site-directed mutagenesis kit according to manufacturer’s instructions (New England Biolabs ...
-
bioRxiv - Cell Biology 2019Quote: ... and shRNAs against mouse DNMBP cloned into the pRFP-C-RS vector (TF515449, Locus ID 71972) were purchased from OriGene. Cdc42F28L-HA was provided by Richard A ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-2272) were expressed with a C-terminal Myc-DDK (FLAG) tag from a pCMV6-Entry backbone (#RC218208, Origene, USA) in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Lentiviral particles containing pLenti-C-PPARG2-mGFP-P2A-Puro or pLenti -mGFP-P2A-Puro were purchased from Origene (Maryland, USA). Titers were provided by the manufacturer ...
-
bioRxiv - Developmental Biology 2019Quote: ... Short RNA hairpin (sh-RNA)-based expression vectors for RNA interference pRFP-C-RS (FZD10 shRNAs and scrambled shRNA) were purchased from Origene. The three sequences were ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid containing source cDNA sequence for Mus musculus MIM (NM_144800) with C-terminal myc- and FLAG-tag was purchased from Origene (MR210506). All plasmids were sequenced to confirm the correct coding sequence (Eton Bioscience).
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Blots were blocked for 1 hour at room temperature with 2% BSA diluted in PBST and incubated overnight at 4 °C with 25 μg/ml of PLG (Origene) diluted in blocking solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... wells were blocked with 1% BSA diluted in PBS for 30 min at 37 °C and increasing amounts (0 μg to 3 μg) of PLG (Origene) diluted in blocking solution were added to the wells and incubated for 1 hour at 37 °C ...
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were generated by transfection of HEK 293 cells with the respective plasmid and pLenti-C-mGFP-P2A-Puro Lentiviral Gene Expression Vector (Cat. #PS100093, Origene). Lipofectamine 2000 (Cat.# 11668030 ...
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Cancer Biology 2023Quote: ... The OC2 overexpression construct was generated by cloning the full-length OC2 cDNA (NM_004852) into the pLenti-C-Myc-DDK-IRES-Puro (Origene #PS10069) lenti-virus system ...
-
bioRxiv - Neuroscience 2024Quote: ... U251-MG cells were stably transfected with a GFP-tagged YTHDF2 expression plasmid pLenti-C-mGFP-P2A-Puro (OriGene, #RC230306L4) or GFP empty vector by lipofectamine 2000 according to the procedure recommended by the manufacturer ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Neuroscience 2024Quote: ... Louis, MO) (96, the C-terminal HA-tagged ERα was constructed from the purchased ERα cDNA expression clone (Origene #MG227304) into BamHI and EcoRI sites of pcDNA3 vector using PCR amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...
-
bioRxiv - Cancer Biology 2020Quote: The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase):
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3×104 HT29 cells and 3×105 Caco2 cells were seeded in 6-wells plates and transduced with the Human Tagged ORF Clone lentiviral particles containing the pLenti-C-mGFP-P2A-Puro vector fused to the CaSR gene (RC211229L4V, OriGene, USA) (HT29CaSR-GFP and Caco2CaSR-GFP) ...
-
bioRxiv - Physiology 2021Quote: ... GGC CCG ATT GCT TCG AGA A (Nrf1) and pRFP-C-RS scrambled shRNA plasmid vectors were obtained from OriGene (TR30015). For analgesia ...
-
bioRxiv - Neuroscience 2022Quote: Stable knockdown of Cebpg in 50B11 cells was done by transfecting 50B11 cells with pGFP-C-shLenti carrying shRNA against Cebpg (1µg/ml; TL709448; Origene, Rockville, MD) following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviruses were produced by transfecting HEK293T/17 cells with the pLenti-C-mGFP vector where SCXB has been inserted (OriGene, Rockville, MD) expressing Scx-GFP and two packaging plasmids33 (pCMV-dR8.2 ...
-
bioRxiv - Biochemistry 2020Quote: Viral vectors expressing lentiviral particles with 4 unique 29mer target-specific shRNA (A/B/C/D) to murine PRDX4 and 1 scramble control (non-specific or NS) were purchased from Origene (Rockville, MD). MIN6 cells were seeded on 48 well plates and cultured overnight in 0.3 mL medium ...
-
bioRxiv - Microbiology 2021Quote: ... A549-expressing human ACE2 (A549ACE2) cells were generated by transducing A549 cells with the ACE2-expressing lentiviral vector (pLenti-C-mGFP-ACE2) (Origene, Cat# PS100093) and then selected with puromycin according to the manufacturer’s procedure.
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4 °C using a rabbit polyclonal anti-GLP-1R antibody (1:50; Origene, Rockville, MD, USA, TA336864). Specificity of GLP-1R antiserum has been previously described in detail [21–23] ...
-
bioRxiv - Cell Biology 2023Quote: ... The manufacturer’s protocol was used for viral production by mixing pLenti-C-TAZ-mGFP-P2A-Puro with packaging plasmids and transfection reagent from the Lenti-vpak packaging kit (OriGene, Cat#TR30037). The mixture was transfected into HEK293T cells to generate pseudoviral particles ...
-
bioRxiv - Cell Biology 2023Quote: ... The OGT lentiviral vector was produced by first cloning OGT with C-terminal FLAG and HA tags into the pCMV6 entry vector (Origene, Rockville, MD) using the NEBuilder HiFi DNA assembly and Q5 site-directed mutagenesis kits according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2019Quote: MDA-MB-231 shRNA cells were generated through lentiviral transduction using HuSH shRNA plasmid panels (29 mer) with pGFP-C-Lenti vectors and the Lenti-vpack Packaging Kit (TR30037) according to manufacturer guidelines (OriGene Technologies, Rockville, MD). shRNA plasmids included four LPL shRNAs and a negative control (TL311692) ...
-
bioRxiv - Pathology 2023Quote: Human astrocytes used co-culture were first transduced with lentiviruses carrying GFP (LentiORF control particles of pLenti-C-mGFP-P2A-Puro Origene™ cat# PS100093V), CLU (Lenti ORF particles ...
-
bioRxiv - Immunology 2024Quote: mRNA was synthesized encompassing the open reading frame of a fusion protein coding for the full-length ANKRD55 isoform 201 coupled to C-terminal MYC-FLAG tags as provided by a commercial vector (Origene, Cat. No. RC221211). Unmodified synthesized ANKRD55 mRNA transcript was capped at the 5’ end using wild-type bases CleanCap® AG (TriLink BioTechnologies ...
-
bioRxiv - Cancer Biology 2022Quote: The expression plasmids pCMV6-Entry-Empty and pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc were purchased from Origene (Tema Ricerca, Bologna, Italy). pGL3-NF-κb reporter ...
-
bioRxiv - Immunology 2023Quote: Bone marrow cells from the femurs of LB2 mice were isolated and transduced with either scrambled or Annexin A1 (Anxa1) shRNA using TR30030 pRFP-C-shLenti vector (Origene Technologies Inc. MD, USA) at an MOI of 150 ...