Labshake search
Citations for Origene Technologies :
201 - 250 of 386 citations for Inhibin beta C chain INHBC Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Human MR1 transcript variant 1 (NM_001531) cDNA clone was purchased from Origene (Rockville, MD). The constructs were then cloned into a lentiviral expression vector with a multiple cloning site separated from GFP reporter via an Internal Ribosomal Entry Site (IRES ...
-
bioRxiv - Cell Biology 2020Quote: ... and human pCMV6-KLHL41-Myc-DDK (RC200295) were purchased from Origene (Rockville, MD, USA). The control (D-01910-10-50) ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 2 (NM_016657) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC216726), KDELR3 transcript variant 1 (NM_006855 ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 1 (NM_006855) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC201571), pCMV6-Entry Tagged Cloning mammalian vector with C-terminal Myc-DDK Tag (Origene ...
-
bioRxiv - Cancer Biology 2019Quote: ... To knock down 4E-BP1 we used pGFP-V-RS EIF4EBP1 Human shRNA (OriGene) versus scramble and control vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cryopreserved normal human kidney and tonsil tissue blocks were purchased from Origene (Rockville, MD).
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2022Quote: ... The human Hsp47 cDNA in pCMV6-XL5 plasmid was obtained from Origene (catalog#: SC119367). Scrambled siRNA GFP lentivector (catalog # ...
-
bioRxiv - Biochemistry 2023Quote: ... The wild-type human genes mS25 and bS16m were obtained in plasmids from OriGene. Mutations of cysteine/s in bS16m and mS25 coordinating Fe-S clusters to alanine ...
-
bioRxiv - Cell Biology 2023Quote: ... which were stably transfected with the human PML-VI gene (RC220236, OriGene, Rockville, MD), were selected using neomycin and were designated as HEKPML cells [34] ...
-
bioRxiv - Cell Biology 2023Quote: ... The following substrates were used in reactions: 0.15 µg of recombinant human Treacle (OriGene), and ~25 nM Pol I or Pol II isolated from S ...
-
bioRxiv - Biophysics 2024Quote: The commercial clone of full-length human hERG (NM_000238.3) cloned in pCMV6-XL4 (Origene) was subcloned in pmCherry-N1 (Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... and C and Nuak kinases 1 and 2 were purchased from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2019Quote: ... and siRNA C: SR422988C) or scrambled siRNAs (SR30004) were purchased from OriGene. Transfection was performed according to the vendor’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: pCMV6-c-MAF plasmid DNA was purchased from OriGene (Rockville, MD, USA). pCMV6-empty vector was used as a control ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentivirus transduction for mGFP (pLenti-C-mGFP-P2A-Puro - Origene Cat# RC211875L4V), CLU_mGFP (CLU(mGFP-tagged)- human clusterin(CLU ...
-
bioRxiv - Cell Biology 2024Quote: ... mammalian vector with C-terminal Myc-DDK Tag (PS100001, Origene, Rockville, MD) as control were used ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant human Lsm12-expression plasmids were obtained either commercially (pCMV-Lsm12-Myc-FLAG from OriGene) or were constructed with pcDNA6 (pCDNA6-Lsm12-FLAG-His) ...
-
bioRxiv - Cell Biology 2020Quote: ... THP1-derived macrophages were transfected with 10 nM siRNA targeting human TRPM7 (SR310261, OriGene, USA) following the manufacturer’s instructions using siTran1.0 (OriGene ...
-
bioRxiv - Molecular Biology 2020Quote: A human cDNA panel covering 48 major tissues was obtained from Insight Biotechnology (Origene HMRT104). Two RIF1 splicing variants were amplified by competitive PCR using a single primer pair (LW030 and LW031) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The IFIH1 gene was deleted using a MDA5 (IFIH1) Human Gene Knockout Kit (OriGene, KN415661) according to the manufacturer’s instructions with target sequences (5’-CTGGATGTACATTTTCACCC-3’).
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length cDNA for Human KCNT1 Transcript 1 NM_020822.1 (Origene Technologies Inc, Rockville, MD, USA) was mutagenised to induce point mutations ...
-
bioRxiv - Biochemistry 2023Quote: Human cell derived recombinant eIF2A-FLAG was expressed in HEK293T cells obtained commercially (OriGene # TP304303) and buffer exchanged into Protein Storage Buffer (25 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... the full length of FOXM1B was amplified from FOXM1 (NM_202003) Human cDNA Clone (#SC128214, Origene) then fused with the pBMN DHFR(DD)-mVenus ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with 5 μg/ml anti-human FcγRIIa (Origene, clone OTI9G5; 5 μg/ml) in blocking solution at 4°C overnight ...
-
bioRxiv - Cancer Biology 2019Quote: ... which is fused with a turboGFP gene at C-terminal (OriGene, Cat # RG217050) into HCT116 cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells transduced with the empty pLenti-C-mGFP-P2A-Puro vector (PS100093, OriGene), (HT29GFP and Caco2GFP ...
-
bioRxiv - Microbiology 2020Quote: Vectors expressing C-terminally FLAG-tagged ATP6V0C and ATP6V0C” were obtained from OriGene Technologies Inc ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coverslips were then incubated overnight at 4 °C with EWS (Origene, 1:200) and pH2AX (CST ...
-
bioRxiv - Cell Biology 2021Quote: The vector expressing myc-DDK-tagged-human wt DDX6 was purchased from OriGene (RC209431, Rockville, MD). The helicase-deficient DDX6 E247A mutant was constructed by overlapping PCR using primers oVM506 5’-ACTTATCTGCCGCATCCAATACTATCATCTGGACATGAT-3’ and oVM507 5’-TTGGATGCGGCAGATAAGTTGCTGTCACAGGATTTTGTG-3’ ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser126 to Arg in GPT and Ser153 to ARg in GPT2 was performed with the Q5 site-directed mutagenesis kit frm NEB (#E0554).
-
bioRxiv - Biophysics 2021Quote: ... DNA encoding ctSTIM1 (aa 233-685) was amplified by PCR from full-length human STIM1 (Origene), appending an N-terminal NcoI cleavage site ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transiently transfected with a human KLK10-encoding plasmid (pCMV6-KLK10-Myc-DDK; Origene RC201139) at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified human AXIN1-MYC/DDK (TP308349) and TPX2-MYC/DDK (TP305821) proteins were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554) ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: Genes encoding NL-Gal3 (IDT, Coralville, IA, USA) and recombinant human Gal3 (OriGene, Rockville, MD, USA) were inserted into pET-21d(+ ...
-
bioRxiv - Cell Biology 2023Quote: ... Human siRNA Oligo Duplex for N-Cadherin (SR300716) and α-Catenin (SR301060) were purchased from Origene. siRNA was transiently transfected to the cells through Lipofectamine RNAimax (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... The human full-length Mtss1 expression construct was purchased from Origene (pCMV6-hMtss1, Cat# RC218273, USA), and Myc-tagged Mtss1 deletion constructs (Mtss11I-BAR [amino acids deleted ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: ... A nontargeting 29-mer scrambled shRNA cassette in pGFP-C-shLenti vector (TR30021, OriGene) served as a control ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: ... A 29-mer scrambled shRNA cassette in the pGFP-C-shLenti vector (TR30021; Origene) was used as the off-target control ...
-
bioRxiv - Cell Biology 2023Quote: ... The spectrin-silencing shRNA plasmids were constructed in the pRFP-C-RS backbone (Origene). These plasmids allow cloning and expression of shRNA under a U6 promoter and co-expression of the TurboRFP red fluorescent protein under the control of a CMV promoter ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-C-Myc-DDK-P2A-Puro Lentiviral Gene Expression Vectors were acquired from Origene (NPEPPS RC209037L3 ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Cancer Biology 2019Quote: ... The TissueScan™ Tissue qPCR Array containing cDNAs for human lymphoma I-II was purchased from Origene. Relative expression of Rictor was determined using inventoried Taqman probes and PCR master mix from Applied Biosystems ...