Labshake search
Citations for Origene Technologies :
301 - 350 of 351 citations for Rat CPSF7 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... PIK3Cδ overexpressing plasmid (pCMV6-PIK3Cδ-AC-GFP) and the empty vector (pCMV6-AC-GFP) were purchased from Origene. All other reagents were purchase from Thermofisher Scientific.
-
bioRxiv - Molecular Biology 2021Quote: ... K273A CFTR was generated using the Quick change method (Quiagen) in the pCMV6-ac-CFTR-GFP plasmid (Origene). Hek293T cells were transfected with Lipofectamine 3 according to manufacturer’s recommendation (Thermo Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were transfected with 1.25ug of LI9LI10 mini-gene and 1.25ug of plasmid DNA of the SF/RBP of interest (all Origene) using Lipofectamine 3000 ...
-
bioRxiv - Molecular Biology 2022Quote: H9c2 cells were transfected with plasmid containing DDK-tagged mouse JCN (Accession number: NM_133723, Origene, Rockville, MD, USA) or its mutant (K8R/K102R/K107R/K140R ...
-
bioRxiv - Cancer Biology 2023Quote: ... and packaging plasmids Lenti-vpak packaging kit with transfection reagent (TR30037) were purchased from OriGene (Rockville, MD, USA) and the experiments were conducted following the instruction of the kit.
-
bioRxiv - Cell Biology 2023Quote: pCMV6-AC-tGFP plasmid vector encoding EIF2B5 (#RG202322) and EIF2S1 (#RG200368) was purchased from OriGene (Rockville, Maryland, USA). The coding open reading frame of EIF2B5 from the pCMV6-AC-tGFP vector was cloned into an empty pCMV6-AC-mGFP (#PS100040 ...
-
bioRxiv - Cancer Biology 2019Quote: ... each cell line (PEA1 and PEO1) was transfected using Fugene® with the following overexpressing plasmids: ZMAT3 (RC202508, Origene), GPR171 (RC207757 ...
-
bioRxiv - Molecular Biology 2020Quote: ... was inserted into PX459 V2.0 plasmid and transfected into U2OS and HAP1 cells with GenJet-OS (SignaGen) and Turbofectin (Origene) respectively according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid encoding GFP-tagged TRIM72 (GFP-MG53) and the corresponding empty vector (GFP-Turbo) were purchased from OriGene Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 x 106 iPSNs were nucleofected with 5 μg of antibody and 4 μg Trim21 GFP plasmid DNA (Origene) with Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza ...
-
bioRxiv - Cancer Biology 2019Quote: ... CRISPR/Cas9 plasmid at 2 μg concentration was transfected by Turbofectin 8.0 following the protocol from OriGene (Rockville, MD).
-
bioRxiv - Microbiology 2019Quote: ... The lentiviral expression plasmid pLenti-C-Myc-DDK harboring the human vimentin gene (NM_003380, pLenti-VIM) was obtained from Origene. To generate lentiviruses ...
-
bioRxiv - Genomics 2021Quote: 2µg of targeting sgRNA plasmids were transfected (separately for the sgRNA targeting the same gene) using turbofectin (Origene, TF81001) following the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2021Quote: ... When cells reached ∼80% confluency cells were transiently transfected with NDUFAF1(NM_016013) C-Myc/DDK-tagged plasmid (Origene #RC200029) with Lipofectamine 3000 (Thermo #L3000001 ...
-
bioRxiv - Physiology 2020Quote: ... A pCMV6-myc-DDK-Fbxl22 full-length cDNA (GenBank Accession Number: NM_175206) plasmid was purchased from Origene (Rockville, MD). The full-length Fbxl22 variant was termed Fbxl22-236 in this study ...
-
bioRxiv - Neuroscience 2021Quote: ... 200.000 cells were resuspended in the nucleofection solution containing 800 ng plasmid DNA (SC118279, Origene, or eGFP in pcDNA3.1) and analysed after 72 h.
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... the coding sequence without stop codon was amplified by PCR from the Myc-DDK-tagged CDK5RAP3 (tv3) plasmid (Origene Technologies ...
-
bioRxiv - Biophysics 2023Quote: HEK cells were transfected with plasmid encoding the +SS4 isoform of N1β with a C-terminal tGFP tag (Origene) (HEK-N1β ...
-
bioRxiv - Physiology 2023Quote: ... PGC1α or HNF4α overexpression was induced using plasmids from Addgene as gifts from Toren Finkel (#10974)31 and Gerhart Ryffel (#31100).32 QPRT plasmid was purchased from Origene (RC202960). Plasmids were transfected using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: ... and Porcine (XM_021097682) ALPL expression plasmids were cloned into the EcoRI and XbaI restriction sites of the PCMV6-AC (Origene) using gBlocks (Integrated DNA Technologies ...
-
bioRxiv - Physiology 2023Quote: Mammalian expression plasmid encoding human TMEM263 with a C-terminal epitope tag (Myc-DDK) was obtained from Origene (RC203933). Control pCDNA3.1 empty plasmid was obtained from Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... we purchased wild-type mammalian expression plasmids with C-terminal FLAG tag were purchased from Origene (Origene Technologies Inc., RC209752). The RNF114 C8A mutant was generated with Q5 site-directed mutagenesis kit according to manufacturer’s instructions (New England Biolabs ...
-
bioRxiv - Genetics 2019Quote: The human wild-type ARSA cDNA (cloned in the pCMV6 plasmid) was purchased from Origene (Cat. No. RC204319, Origene, USA). The c.925G mutations (c.925G>A ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a human GAB1 3′-UTR reporter plasmid (containing 3770 bp immediately downstream of the end of the GAB1 ORF cloned into pMirTarget, Origene), a control Renilla luciferase plasmid (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... MG87.TRKA and MG87.TRKB cells were transfected with PTPσ (RefSeq number NM_019140) Myc-DDK-tagged open-reading frame (ORF) plasmid purchased from OriGene (#RR209636), pCMV6-Entry vector with C-terminal Myc-DDK Tag (#PS100001 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were transfected in 12-well plates via reverse transfection where purified empty or FLAG-tagged METTL7B overexpression plasmids (Origene) were mixed with P3000 reagent in OptiMEM at room temperature followed by Lipofectamine 3000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... each well was transfected with 1 μg total dciCas9-VPR and CXCR4 sgRNA plasmids (450 ng dciCas9-VPR, 450 ng CXCR4 sgRNA, 100 ng mCherry control) using Turbofectin (Origene) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354, OriGene). The SIK3-Flag plasmid was constructed by subcloning of a 3xFlag tag to replace the Myc-DDK tag in the mSIK3-Myc-DDK plasmid (MR211912 ...
-
bioRxiv - Physiology 2023Quote: ... The SIK3-Flag plasmid was constructed by subcloning of a 3xFlag tag to replace the Myc-DDK tag in the mSIK3-Myc-DDK plasmid (MR211912, OriGene). SIK3-Flag-ΔPKA (ΔPKA ...
-
bioRxiv - Biochemistry 2023Quote: Plasmid pCMV6 encoding cDNA for human RHBDL2 and RHBDL4 with a C-terminal myc-FLAG tag was obtained from OriGene, USA ...
-
bioRxiv - Cell Biology 2023Quote: ... transient or tetracyclin-inducible expression of human HEATR5B with an N-terminal GFP tag in human cells) were cloned by Gibson assembly with the full-length human HEATR5B open reading frame (derived from plasmid RC22610 (Origene)) and either pcDNA3.1-eGFP-linker or pcDNA5-FRT/TO-eGFP-linker plasmids (coding for eGFP and a GGSGGSGG linker ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were generated by transfection of HEK 293 cells with the respective plasmid and pLenti-C-mGFP-P2A-Puro Lentiviral Gene Expression Vector (Cat. #PS100093, Origene). Lipofectamine 2000 (Cat.# 11668030 ...
-
bioRxiv - Neuroscience 2024Quote: ... U251-MG cells were stably transfected with a GFP-tagged YTHDF2 expression plasmid pLenti-C-mGFP-P2A-Puro (OriGene, #RC230306L4) or GFP empty vector by lipofectamine 2000 according to the procedure recommended by the manufacturer ...
-
bioRxiv - Immunology 2024Quote: ... The number of MT-ATP6 copies per microliter was determined based on a standard curve developed using serial dilutions of a commercially available DNA plasmid (OriGene) with complementary DNA sequences for human MT-ATP6.
-
bioRxiv - Molecular Biology 2024Quote: NSC34 and HEK293T cells were transfected with a plasmid coding for the hnRNPA2B1 (NM_002137) Human Tagged ORF Clone (Origene, RC219318) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen L3000001) ...
-
bioRxiv - Immunology 2023Quote: A plasmid vector constitutively expressing the Rorc gene under the control of the CMV promoter (pCMV6-Rorc) (Origene, No. MR222309) was co-transfected with a plasmid expressing the luciferase gene (Luc ...
-
bioRxiv - Cell Biology 2024Quote: The generation of human cMPL receptor-expressing HEK293-A cells was achieved through a lipofectamine-mediated transfection of a plasmid expressing cMPL and GFP (Origene), previously linearized using the Scal restriction enzyme (NEB) ...
-
bioRxiv - Immunology 2022Quote: ... Cells (1 × 105) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Cancer Biology 2019Quote: For exogenous over-expression of CD82 and KDELR3 genes the following expression plasmids were used: CD82 transcript variant 1 (NM_002231) Human Untagged Clone (Origene, CAT#: SC324395), pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+ and HEK293/GC-B+ cell lines were generated from HEK293 parental cell transfected with plasmids (OriGene, Rockville, MD) containing either human GC-A or GC-B cDNA sequences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Biochemistry 2023Quote: ... the lateral and contralateral tibialis anterior were injected with 30 µg of either control empty vector pCMV6 or Nr2f6-myc-flag overexpression plasmid (Origene, #MR206083) and 220V/cm were applied in 8 pulses of 20/200 ms on/off (ECM 830 Electroporator ...
-
bioRxiv - Physiology 2021Quote: ... and with 300 ng of cDNA plasmid encoding wild-type or mutant human TRPA1 (pCMV6-XL4 vector, OriGene Technologies, Rockville, MD, USA). The cells were used 24–48 h after transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... constructs in the pGFP-V-RS vector and a non-targeting (NT: gcactaccagagctaactcagatagtact) pGFP-V-RS plasmid were purchased from OriGene (Cat. # TL515175). For lentivirus-mediated expression ...
-
bioRxiv - Cell Biology 2023Quote: ... The manufacturer’s protocol was used for viral production by mixing pLenti-C-TAZ-mGFP-P2A-Puro with packaging plasmids and transfection reagent from the Lenti-vpak packaging kit (OriGene, Cat#TR30037). The mixture was transfected into HEK293T cells to generate pseudoviral particles ...
-
bioRxiv - Physiology 2023Quote: ... were transiently transfected as described above with a plasmid encoding C-terminal Myc-FLAG epitope-tagged human TMEM65 (TMEM65-Myc-FLAG) (Origene #RC207368; NM_194291). Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001 ...
-
bioRxiv - Cancer Biology 2019Quote: Overexpression of LPL was performed using a human LPL clone in pCMV-6AC plasmid vector synthesized by OriGene (Rockville, MD; Cat. No. SC322258). An empty pCMV-6AC (“pCMV Neo” ...
-
bioRxiv - Cancer Biology 2022Quote: The expression plasmids pCMV6-Entry-Empty and pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc were purchased from Origene (Tema Ricerca, Bologna, Italy). pGL3-NF-κb reporter ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...