Labshake search
Citations for Origene Technologies :
151 - 200 of 351 citations for Rat CPSF7 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Lentiviral expression plasmids for ZNF416 were purchased from Origene, Inc (Origene ...
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmid pCMV6-WSB2 (NM_018639.3) was purchased from OriGene. Loss-of-function MT DDB2 (WDΔ238-278) ...
-
bioRxiv - Neuroscience 2022Quote: A plasmid encoding human TrkB was purchased from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: The LIX1 expressing plasmid was from Origene (#SC108332, USA). The cDNA encoding human LIX1 was subcloned in the pCS2HA plasmid to generate the HA-LIX1 fusion protein in which the HA-tag is at the N-terminus of LIX1 ...
-
bioRxiv - Molecular Biology 2022Quote: The pCMV6-Entry-ZNF692 plasmid was purchased from Origene. Human cDNAs of full length ZNF692 were amplified by PCR and cloned to pIRES-puro-GFP and pIRES-puro-FLAG vectors with restriction enzymes FseI and AscI ...
-
bioRxiv - Cancer Biology 2021Quote: Human LDHA plasmid was purchased from Origene (MD, USA). Succinylation mutants of LDHA were generated using site-directed mutagenesis kit (GeneAll ...
-
bioRxiv - Developmental Biology 2019Quote: Piga plasmid was obtained from Origene (Rockville, MD, #MR222212). Antisense probes were generated from PCR products containing T3 overhangs ...
-
bioRxiv - Cancer Biology 2019Quote: SLC7A5 siRNA and plasmid DNA were obtained from OriGene. Products used were SLC7A5 (ID 8140 ...
-
bioRxiv - Immunology 2019Quote: ... A plasmid encoding NLRC4 was purchased from Origene (RC206757) and cloned into the Gateway system ...
-
bioRxiv - Genetics 2020Quote: ... the amplicon was subcloned into pCMV6 plasmid (Origene Technology) in frame with Myc and Flag tag by In-Fusion HD EcoDry Cloning Plus System (Takara Bio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse OSM expression plasmid (MR226014) was purchased from Origene. Mouse STAT3-Y705F plasmid was kindly provided by Prof ...
-
bioRxiv - Biochemistry 2023Quote: Mouse RBM3 gene from RBM3-PUC plasmid (Origene MC203679) was cloned into pMIG-GFP plasmid by restriction digestion method using Bgl2 and EcoR1 (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids (Myc-tagged TSPO (‘TSPO-Myc’; catalogue # RC220107, OriGene) or a pCMV EV control (catalogue # PS100001 ...
-
bioRxiv - Molecular Biology 2024Quote: ... FLAG-tagged human angiogenin plasmid (hANG) (OriGene, Cat# RC208874) and Mock plasmid were transiently transfected according to the manufacturer’s protocol into HEK293T cells in full growth medium using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... OxtR protein expression was assessed by immunostaining with goat anti-rat OXTR antibody (1:100; Origene) and revealed with Alexa Fluor® 594 labeled rabbit anti-goat antibody (1:300 ...
-
bioRxiv - Molecular Biology 2021Quote: Alkbh1 Rat Tagged ORF Clone Lentiviral Particles and Mock control were purchased from Origene (Cat# RR214755L2V). Cells were transfected with lentiviral particles in the presence of polybrene (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfer plasmid containing the A20 insert was obtained from Origene (MR210582L4 ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid containing human IL-12p35 cDNAs were obtained from Origene. One day before transfection ...
-
bioRxiv - Developmental Biology 2019Quote: ... and Tbxt (#MR223752) plasmids were obtained from Origene (Rockville, MD). Antisense probes were generated from PCR products containing T3 overhangs ...
-
bioRxiv - Neuroscience 2021Quote: Plasmid encoding myc-tagged mouse MARCKS was purchased from Origene. Plasmid encoding HA-PKCα was a gift from Bernard Weinstein (Addgene plasmid #21232) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plasmid encoding Flag-Bcl-XL was purchased from OriGene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2021Quote: ... Myc- and DDK-tagged hemopexin plasmid was purchased from Origene. Glycosylation and cysteine mutations were made with the Quick Change II Site-Directed Mutagenesis kit (Promega) ...
-
The heterogeneity of the DNA damage response landscape determines patient outcomes in ovarian cancerbioRxiv - Cell Biology 2021Quote: ... were transformed with reconstituted pCMV6-AC-GFP plasmid (ps100010; Origene). EcoRI-HF (R3101S) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLAG-tagged human angiogenin plasmid (Cat# RC208874; OriGene; Rockville, MD), GFP-tagged rat RNH1 plasmid (Cat# ORa42809C ...
-
bioRxiv - Genetics 2022Quote: ... WT ALDH9A1 cDNA plasmid was purchased from OriGene (cat#: 216921). A nonsynonymous missense variant (c.26c>G ...
-
bioRxiv - Neuroscience 2022Quote: ... (1) the commercial template plasmid pCMV6-Entry-UBE3C (Origene #:RC215110) was amplified using primers which partially inserted the intergenic fusion sequence and simultaneously deleted the UBE3C coding sequence downstream of p.Val443 (F ...
-
bioRxiv - Cancer Biology 2020Quote: ... of the two shHIP1 constructs (Origene, HuSH pRS plasmids #TR312457) in PNT1A and DU145 followed by selection with 2.0μg/ml final concentration of Puromycin (Sigma #P9620 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were transfected with plasmid (pCMV6-entry from Origene) and siRNA constructs (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 7.5 μg donor plasmid (pAAVS1-Puro-DNR; Origene GE100024) containing doxycycline inducible dCas9-KRAB with Fugene HD (Promega ...
-
bioRxiv - Immunology 2022Quote: The human Myc-NEU3 expression plasmid RC216537 (Origene, Rockville, MD) was used to express NEU3 ...
-
bioRxiv - Neuroscience 2022Quote: Plasmids: HA-tags were attached to mouse VASH1 (Origene, MR222520) and VASH2 (Origene ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following plasmids were used: pCMV6-XL5-KLF4 (#SC123501; Origene) and pCMV6-Entry (#PS100001 ...
-
bioRxiv - Biochemistry 2023Quote: ... and for overexpression with lentiviral expression plasmid for DCP1b (OriGene). As a control luciferase shRNA was used ...
-
bioRxiv - Cancer Biology 2024Quote: ... CD98hc overexpression plasmid pCMV6-Myc-DDK was purchased from Origene.
-
bioRxiv - Cell Biology 2024Quote: Myc-DDK-tagged ATP6V0A1 expression plasmid (RC226206, Origene, Rockville, MD) for ATP6V0A1 induction and pCMV6-Entry ...
-
bioRxiv - Neuroscience 2021Quote: Plasmid encoding for ABI3 (NM_016428) was purchased from OriGene (Catalog# RC202853). Site directed mutagenesis in ABI3 was performed and resulting clones were Sanger sequenced to confirm the presence of mutation ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pCMV6-Pdcd7-Myc plasmid was obtained from Origene (OriGene, #MR214517).
-
bioRxiv - Cancer Biology 2022Quote: A plasmid containing the hAHRWT sequence was purchased from Origene (RC209832). The Q383H point mutation was introduced with site-directed mutagenesis with forward primer cattgtaactcacagaccactaacagatg and reverse primer gttagtggtctgtgagttacaatgatataatc ...
-
bioRxiv - Genetics 2020Quote: Mouse expression plasmids containing cDNA encoding Rhbdf1 was obtained from OriGene. The Q5® Site-Directed Mutagenesis Kit was used to introduce site-specific mutations in the mouse Rhbdf1 plasmid according to the manufacturer’s instructions and confirmed by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... or the corresponding empty vector plasmid (PS100001, Origene, Rockville, MD, USA). 22Rv1 SLFN5 KO cells were further transfected with SLC7A5 (NM_003486 ...
-
bioRxiv - Cell Biology 2022Quote: ... and pCMV6 Entry Vector plasmid (pCMV6-EV) were obtained from Origene. The human FLAG-tagged EMC3 plasmid was purchased from GenScript (catalog # ...
-
bioRxiv - Neuroscience 2022Quote: Short interference mouse PCBP1 RNAi plasmids were purchased from Origene (TL502540). Lentiviral particles expressing the PCBP1 shRNAi or scramble control were produced by the VirusTech Core Facility ...
-
bioRxiv - Molecular Biology 2019Quote: ... PSMB5-Myc-FLAG WT plasmid was purchased from OriGene (CAT#: RC209326L3). siRNA transfections were performed using Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNF4-Myc-FLAG WT plasmid was purchased from OriGene (CAT#: RC207273). PSMB5-Myc-FLAG WT plasmid was purchased from OriGene (CAT# ...
-
bioRxiv - Cell Biology 2020Quote: ... Climp-63-Myc plasmid was acquired from Origene (catalog no: MR215622). The plasmid was transfected into Hepa 1-6 and Cos-7 cells using lipofectamine LTX overnight in OptiMEM media and the experiments were done after 36-48h after transfection.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Mammalian overexpression plasmids and siRNA were purchased from Origene (Rockville, MD). HepG2 and HeLa cells were obtained from ATCC (Manassas ...
-
bioRxiv - Biochemistry 2020Quote: The gfpt2 gene was amplified from pCMV6-AC plasmid (Origene, USA) by PCR and inserted into bacterial expression plasmid pET23a (Novagen ...
-
bioRxiv - Cell Biology 2022Quote: ... Frataxin plasmid (pCMV6-FXN-Myc-FLAG) was purchased from Origene (RC204880). The lentiviral 4xGFP11-SEC61B plasmid (pHAGEF2-EF1a-4xGFP11-SEC61B-IRES-Hygro ...
-
bioRxiv - Physiology 2022Quote: ... The mouse RUNX2-Myc/DDK plasmid was purchased from OriGene (MR227321), then subcloned into pLV-EF1a-IRES-Hygro (Addgene #85134) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid pCMV6-XL5-LAMP2A was purchased from Origene (Cat nr #: SC118738) and used for transfection with ViaFect from Promega according to the manufacturers recommended procedure ...