Labshake search
Citations for Origene Technologies :
201 - 250 of 314 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: U251 TMX2 KO cells were generated with the TMX2 Human Gene Knockout Kit (OriGene, KN400032). The pCas-Guide vector (OriGene ...
-
bioRxiv - Cell Biology 2021Quote: The vector expressing myc-DDK-tagged-human wt DDX6 was purchased from OriGene (RC209431, Rockville, MD). The helicase-deficient DDX6 E247A mutant was constructed by overlapping PCR using primers oVM506 5’-ACTTATCTGCCGCATCCAATACTATCATCTGGACATGAT-3’ and oVM507 5’-TTGGATGCGGCAGATAAGTTGCTGTCACAGGATTTTGTG-3’ ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser126 to Arg in GPT and Ser153 to ARg in GPT2 was performed with the Q5 site-directed mutagenesis kit frm NEB (#E0554).
-
bioRxiv - Biophysics 2020Quote: ... The plasmid containing human Sirt3102-399 (pEX-His-hSIRT3102-399) was purchased from OriGene (Rockville, MD).
-
bioRxiv - Biophysics 2021Quote: ... DNA encoding ctSTIM1 (aa 233-685) was amplified by PCR from full-length human STIM1 (Origene), appending an N-terminal NcoI cleavage site ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transiently transfected with a human KLK10-encoding plasmid (pCMV6-KLK10-Myc-DDK; Origene RC201139) at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified human AXIN1-MYC/DDK (TP308349) and TPX2-MYC/DDK (TP305821) proteins were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554) ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: Genes encoding NL-Gal3 (IDT, Coralville, IA, USA) and recombinant human Gal3 (OriGene, Rockville, MD, USA) were inserted into pET-21d(+ ...
-
bioRxiv - Developmental Biology 2024Quote: ... The human full-length Mtss1 expression construct was purchased from Origene (pCMV6-hMtss1, Cat# RC218273, USA), and Myc-tagged Mtss1 deletion constructs (Mtss11I-BAR [amino acids deleted ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Cell Biology 2023Quote: ... Human siRNA Oligo Duplex for N-Cadherin (SR300716) and α-Catenin (SR301060) were purchased from Origene. siRNA was transiently transfected to the cells through Lipofectamine RNAimax (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were transfected with either pEGFP-ARα1b or Myc-DDK-tagged human ARα1b (Origene, Rockville, MD) using Lipofectamine 3000.
-
bioRxiv - Cell Biology 2024Quote: Full-length, human, wild-type GALC cDNA (SC120078, NM_000153) was originally purchased from Origene (Rockville, MD). The cDNA was subcloned into the pBApo-CMV pur expression vector at the XbaI and PstI sites (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: ... expression was carried out in healthy and cancer ovarian tissues by RT-qPCR using Tissuescan™ ovarian cancer cDNA arrays I-IV (Origene Technologies, USA) and EFA6R (NM_206909.3 ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Biochemistry 2020Quote: ... The human doublecortin (DCX) and doublecortin-like kinases (DCLK1, DCLK2, and DCLK3) cDNAs were obtained from Origene in pCMV6 vector that also incorporates C-terminal Myc and FLAG tags (Myc-FLAG ...
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Microbiology 2020Quote: ... human MSR1 (Cat# RC209609) and Beclin 1 (Cat# MR207162) were obtained from Origene (Rockville, MD 20850, USA). pcDNA-FLAG-Ulk1 (Plasmid # 27636 ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...
-
bioRxiv - Cell Biology 2021Quote: rKLK10 (500 ng, described above) was incubated with wild-type human recombinant (rHTRA1) (500 ng, Origene TP322362) or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208 ...
-
bioRxiv - Cell Biology 2022Quote: The full length of human PCDH15-CD1-1 (Q99PJ1, uniport) cloned in pcDNA3.1 was obtained from OriGene. PCDH15-CD2 (Q99PJ1-10 ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... For chaperone over-expression: either human PDEδ (NM_002601.4; Dharmacon MHS6278-202829730) or mouse UNC119A (NM_005148; Origene RC203758) was cloned in front of a T2A site followed by mCherry to allow for co-translational cleavage and expression ...
-
bioRxiv - Cancer Biology 2020Quote: Three unique 27mer RELA human siRNA oligo dupliexes (SR304030A, B and C) were obtained from Origene (SR304030). Universal scrambled negative control siRNA duplex (SR30004 ...
-
bioRxiv - Cancer Biology 2020Quote: Site-directed mutagenesis was performed using 50ng of KAT3A / CBP (CREBBP) (NM_004380) Human Tagged ORF Clone (OriGene) as the dsDNA template ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid containing human Sirt3,102-399 (pEX-His-hSIRT3,102-399) was purchased from OriGene (Rockville, molecular dynamics).
-
bioRxiv - Neuroscience 2022Quote: ... Myc-DDK tagged wild type human α-synuclein (Myc-α-SYN) plasmid constructs were purchased from OriGene technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm-thick paraffin sections were deparaffinized and stained with anti-human KI67 (1:500, TA802544, Origene), anti-mouse Ki67 (1:800 ...
-
bioRxiv - Biophysics 2023Quote: A Myc/DDK eptiope-tagged Pin1 (NM_006221) Human Tagged ORF Clone (Cat# RC202543) was obtained from OriGene Technologies Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Genetics 2024Quote: The plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) was obtained from Origene (#RG221644, NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Molecular Biology 2024Quote: The lentiviral vectors coding sequences for human-GFPT2-GFP and Mock-GFP were obtained from Origene (RC200519L2); pLVX-ATF4 mScarlet NLS (Addgene plasmid # 115969) ...
-
bioRxiv - Cell Biology 2024Quote: The cDNA encoding full-length human SNED1 cloned into pCMV-XL5 was obtained from Origene (clone SC315884). 6X-His-tagged SNED1 previously described (Vallet et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... hTGR5 gene was in pCMV6-Entry (GPBAR1 Human cDNA ORF Clone, NM_001077191; Origene Technologies, Inc., Rockville, MD, USA). The two plasmids were linearized with SalI (mDAT ...
-
bioRxiv - Genetics 2020Quote: TMEM43 (Myc-DDK-tagged)-Human transmembrane protein 43 (TMEM43) (GenBank accession no. NM_024334.2) was purchased from OriGene (RC200998) and cloned into CMV-MCS-IRES2-EGFP vector using BglII/XmaI sites ...
-
bioRxiv - Biochemistry 2022Quote: D-cysteine transport experiments were performed in HEK293 cells transiently transfected with human SLC1A15 (ASCT2; Origene; Cat# RC200305) and rat SLC7A10 (Asc1 ...
-
bioRxiv - Biochemistry 2020Quote: Wild-type human TREM2 (hTREM2) and DAP12 (hDAP12) were subcloned in pCMV6-A vector (Origene, Rockville, MD, USA). A single C→A nucleotide polymorphism (SNP ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNAs encoding murine (pCMV-mDHCR7-Myc/DDK) and human DHCR7 (pCMV-hDHCR7-Myc/DDK) were purchased from Origene (MR223420 and RC228922 for murine and human cDNA clone respectively) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence of full length human WNK1 was derived from a commercial expression vector (#RC218208, Origene, USA). Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336 ...
-
bioRxiv - Genetics 2020Quote: ... PRUNE1 levels in overexpressing HEK293 and in human fibroblasts were analyzed by immunoblotting using anti-PRUNE1 (Origene; TA344725) and/or anti-HA (Abcam ...
-
bioRxiv - Biochemistry 2022Quote: ... or with RhoGDI1 (ARHGDIA) Human siRNA Oligo Duplex (Locus ID 396) (SR300287 OriGene Technologies Inc., Rockville MD, USA) using Lipofectamine 3000 Transfection Reagent (L3000015 Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: The open reading frame of human MIF was amplified by PCR from the vector pCMV6-entry MIF (Origene) and cloned into the pET11a vector (Novagen ...
-
bioRxiv - Immunology 2021Quote: pCMV6-Entry vector encoding Myc-DKK-tagged human wild type (WT) ATAD3A cDNA (NM_018188.4, Q9NV17-1) was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S ...
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Genetics 2020Quote: The full-length human BBS2 clone in the pCMV6-entry vector was obtained commercially (Origene; Clone ID: RC204337). Using this as a template ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transformed by heat shock in 42°C water bath using SETD2 Human Tagged ORF Clone (Origene, RG224760) or pCMV6□AC□GFP Mammalian Expression Vector (Origene ...