Labshake search
Citations for Origene Technologies :
1 - 50 of 314 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... All qPCR primer pair sequences were from OriGene (Rockville, MD).
-
bioRxiv - Bioengineering 2024Quote: ... Primers used in this study were purchased from Predesigned qPCR Assays (Integrated DNA Technologies) or qPCR Primer Pairs (OriGene Technologies, Inc.).
-
bioRxiv - Immunology 2024Quote: ... Specific qPCR primers for human LRP1 were obtained from OriGene (#HP206040). Specific qPCR primers for human GAPDH were designed using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ...
-
bioRxiv - Immunology 2022Quote: ... Gene-specific PCR primer pairs were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR primers were from Origene (MyoVa Fw - CTCACACGAACTCCTGCAAA ...
-
bioRxiv - Immunology 2022Quote: ... the following qPCR primers (Origene) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... QPCR primer sequences were obtained from OriGene website ...
-
bioRxiv - Genomics 2023Quote: ... qPCR primer sequences were provided by OriGene or designed by PrimerQuest™ Tool from Integrated DNA Technologies (IDT ...
-
bioRxiv - Cancer Biology 2024Quote: ... Some qPCR primers were purchased from Origene (Table S3). Cycle threshold values were normalized to those of the housekeeping genes GAPDH ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... then incubation was undertaken with a primary rabbit polyclonal CSF2RA (GM-CSF receptor alpha) antibody for 1 hour (Origene TA323990S ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Cell Biology 2021Quote: ... and human normal brain tissue qPCR array (OriGene Technologies, HBRT101) were used ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A; Origene), and MUC5B (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A) mouse monoclonal antibody (Origene) and MUC5AC monoclonal antibody (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) was performed on cDNA panels of 48 healthy human tissues (OriGene Technologies, Rockville, MD) and TNBC cell lines using MX3000 (Taqman probes ROPN1 ...
-
bioRxiv - Genetics 2021Quote: ... alpha 2 (IFNA2) (OriGene Technologies Inc, Atlanta, GA) (100 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... Primers designed by Origene and span at least one intron-exon boundary ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA encoding rat ANP receptor (GenBank ID: NM_012613) was purchased from OriGene Technologies Inc ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Primers were purchased from Origene Technologies (Rockville ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers were acquired from OriGene and the following sequences for NOX2 (Mus musculus Cybb ...
-
bioRxiv - Cell Biology 2024Quote: Primers were obtained from OriGene Technologies Inc and commercially synthesized (Custom DNA Oligos ...
-
bioRxiv - Cell Biology 2024Quote: ... Ready-to-use primers from Origene for ApoE (HP200028) ...
-
bioRxiv - Cell Biology 2020Quote: ... Pre-designed primers were purchaced from OriGene Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... Primers for ACE2 were obtained from Origene.
-
bioRxiv - Immunology 2020Quote: ... cDNA clones in pCMV6 plasmid for these chemokine receptors were obtained from Origene (Rockville, MD). 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Neuroscience 2023Quote: ... human GBA (Origene), human a-SYN (A53T mutant ...
-
bioRxiv - Cell Biology 2023Quote: ... The sequences for the primers were obtained from Origene and primers were obtained from Metabion ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Microbiology 2022Quote: Human CD164 (Origene, #RC202234) and mouse Cd164 (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... Primer sequences were obtained from Origene (MP208179, MP200232 and MP212857). Primer efficiency was calculated and incorporated in the ΔΔCt method analysis [18].
-
bioRxiv - Immunology 2023Quote: ... 0.75 μl of the forward and reverse primer (OriGene, HP205798), and 10.75 μl of RNase-free water were added to each reaction well followed by 1μl of cDNA ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Cell Biology 2023Quote: ... human FBXO38 cDNA (Origene #RC204380) was cloned into pcDNA3.1 containing N-terminal twinStrepII- FLAG-tag (NSF) ...
-
bioRxiv - Physiology 2023Quote: Human AgRP (Origene CAT#: RC217144) was cloned into CAG-NLS-GFP (Addgene# ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SNAP43 (SNAPC1) (Origene, TP760339), Human MBP (gift of A ...
-
bioRxiv - Cancer Biology 2023Quote: Human SFRP1 (Origene plasmid #RC207328) or Notum (Gateway ORF clone ID #164485821 ...
-
bioRxiv - Neuroscience 2023Quote: ... or human ELP1 (Origene RC2076868), ELP1 (NM_003640) ...
-
bioRxiv - Cell Biology 2024Quote: The generation of human cMPL receptor-expressing HEK293-A cells was achieved through a lipofectamine-mediated transfection of a plasmid expressing cMPL and GFP (Origene), previously linearized using the Scal restriction enzyme (NEB) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Gene-specific primers were designed using Primer3 or obtained from Origene. Sequences are listed in Table 1.
-
bioRxiv - Immunology 2023Quote: ... 0.75 μl of the forward and reverse primers (OriGene, HP207209 and HP210040) and 9.25 μl of RNase-free water were added to each well followed by 2.5 μl of cDNA.
-
bioRxiv - Cancer Biology 2024Quote: ... The primers were designed based on PrimerBank or OriGene (OriGene Technologies, Inc.) and were blasted to confirm the specificity using NCBI primer blast ...
-
bioRxiv - Biochemistry 2020Quote: ... human FGF1-myc-DDK (Origene RC207434), human flag-FGF2 (SinoBiological HG10014-NF) ...
-
bioRxiv - Cancer Biology 2020Quote: ... CXCR4 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Biochemistry 2022Quote: ... human testis FFPE tissue (Origene, CB811079) was first sliced ...
-
bioRxiv - Cell Biology 2021Quote: ... or human GPR87 ORF (Origene, RC218486L3)) for 6 hrs ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human IL-1β (Origene #RC202079L4) plasmid constructs were used for generating stable LNCaP cells ...