Labshake search
Citations for Origene Technologies :
201 - 250 of 630 citations for Human Anti NT5E Recombinant Antibody clone Hu101 28 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... for 1 h at room temperature and incubated with primary antibodies (1:1000 dilution for anti-Calnexin [ThermoFisher, PA5-19169], anti-Syntenin-1 [Origene, TA504796] ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...
-
bioRxiv - Immunology 2022Quote: ... using NKG2D and Ly49A cDNA clone expression vectors (Origene). NKG2D-S/L were generated by PCR using forward 5’ TAGTAGTCTCGAGCCACCATGAGCAAATGCCATAATTACGACCTC 3’ (short isoform ...
-
bioRxiv - Neuroscience 2022Quote: ... the cDNA ORF Clone (OriGene Technologies, Rockville, MD, USA), or pGFP-C-shLenti-NCKAP1 Human shRNA lentiviral particles (ID 10787 ...
-
bioRxiv - Physiology 2022Quote: ... Connexin clones were purchased from Origene (Rockville, MD, USA). Nhe1-linearized hCx43 and hCxCx43S3A were transcribed in vitro to cRNAs using the T7 Message Machine kit (Ambion ...
-
bioRxiv - Biochemistry 2024Quote: ... Mouse Asct2 (NM_009201) TrueORF clone was obtained from OriGene. p3XFLAG-CMV14 empty vector was used for Mock production ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Plaat cDNAs were purchased from ORIGENE [RC208444 for PLAAT1 (NM_020386) ...
-
bioRxiv - Neuroscience 2021Quote: Human cDNA panels were obtained from Origene: TissueScan ...
-
bioRxiv - Biochemistry 2021Quote: ... Human ERβ cDNA was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: ... and human CYB5R1-myc-DDK (OriGene RC205833L3) plasmids were transiently co-transfected into HEK293T cells using PolyFect (Qiagen 301105 ...
-
bioRxiv - Immunology 2024Quote: ... the human MAGE-A4 cDNA (Origene, RC223991) was inserted into the targeting construct downstream of a Lox-Stop-Lox (LSL ...
-
bioRxiv - Microbiology 2020Quote: ... FLAG-tagged MtTop1 was detected with anti-DDK (FLAG) antibodies (Origene, TA50011, 1:2,500). Membranes were incubated with primary antibodies at room temperature for 3 hr ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: goat anti-mCherry (Origene, AB0040-200, 1:500), mouse anti-His (Dianova ...
-
bioRxiv - Neuroscience 2021Quote: ... PVDF membranes were incubated with the indicated primary antibodies (anti-HA: Cell Signaling Technology, C29F4, Rabbit mAb CAT#: 3724, 1:1000; anti-FLAG: Origene, mouse monoclonal antibody ...
-
bioRxiv - Immunology 2024Quote: For Western blotting and ELISA assays, human glutaredoxin 3 (GLRX3, catalog # TP302731) and human Tropomodulin1 (TMOD1, catalog # TP301134) were obtained from OriGene Technologies Inc ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes of blots were successively incubated with anti-Hfq polyclonal antibody from Goat (Origene, Germany), with anti-goat secondary antibody coupled to alkaline phosphatase (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... the following antibodies were purchased: goat anti-tdTomato (RRID:AB_2722750, Origene, Rockville, MD, USA, #AB8181-200), rabbit anti-St8sia1 (RRID:AB_1857534 ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse Csde1 ORF clone (Origene, MR210719, NM_144901, Myc-DDK-tagged) was sub-cloned into FUGW vector including its original Myc-DDK-tag using AgeI/EcoRI restriction sites.
-
bioRxiv - Neuroscience 2021Quote: ... mouse Gpr151 ORF clone (Origene, MR223707, NM_181543, Myc-DDK-tagged) was sub-cloned into FUGW vector including its original Myc-DDK-tag with no any UTRs at AgeI/EcoRI restriction sites ...
-
ANGPTL8 R59W variant influences inflammation through modulating NF-κB pathway under TNFα stimulationbioRxiv - Biochemistry 2023Quote: Wild type and R59W clones (Blue Heron Biotech, OriGene, USA) of ANGPTL8 with Myc-DDK tags were used for transfection using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... The Tmem120b cDNA clone was purchased from Origene (MR205067, NM_001039723). The Opto-PLD active and inactive constructs were purchased from Addgene (140114 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and HA-tagged mouse VHL ORF Clone (Origene; Cat #MR201630) as templates to amplify human and mouse VHL ...
-
bioRxiv - Molecular Biology 2022Quote: ... or mouse MSS51-Myc-FLAG (mouse cDNA clone; Origene MR217897) using Lipofectamine 2000 as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA encoding human TTL (NP_714923, Origene #RC207805L2) was cloned in it for TTL expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human RIOK2-flag cDNAs encoding isoform I (Origene) were cloned into pRev-Tre tetracycline inducible vectors (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: The cDNA sequence of human GAPDH (OriGene, UK) was inserted into the pET-28b(+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Cancer Biology 2022Quote: ... whereas the ORF encoding human p130 from Origene.
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Human CD36 or control shRNA constructs (Origene, TR314090) were transfected into parental HCT116 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Cell Biology 2020Quote: ... or FLAG-mNUP153 (mouse) expression vectors were constructed by amplifying full length human NUP153 or mouse NUP153 cDNA using human NUP153 cDNA (Origene, SC116943) or mouse NUP143 cDNA (ATCC ...
-
bioRxiv - Cancer Biology 2021Quote: Purified RPRM peptides (77-109, ChinaPeptides; 1 μg) were incubated with purified recombinant CDK4 (Origene; 0.2 μg) and CDK6 proteins (Origene ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... OxtR protein expression was assessed by immunostaining with goat anti-rat OXTR antibody (1:100; Origene) and revealed with Alexa Fluor® 594 labeled rabbit anti-goat antibody (1:300 ...
-
bioRxiv - Cell Biology 2020Quote: ... the samples were immunostained with the anti-IRSp53/BAIAP2 antibody 1D9 (mouse monoclonal, 1:200, OriGene) and anti-HLA A antibody EP1395Y (rabbit monoclonal ...
-
bioRxiv - Genomics 2021Quote: ... the corresponding horseradish peroxidase (HRP)-conjugated Goat anti-Rabbit IgG secondary antibody (Origene, Cat#PV-6002) was sequentially used for incubation at room temperature for 30 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary and secondary antibodies were used at the following concentrations: anti-dendra2 1:5000 (OriGene: TA150090), anti-Slack 1:5000 (Aves labs ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA clone for Cap1 was purchased from Origene (CAT#: MR207594) and subsequently cloned into lentiviral vector pLVX-puro (Clontech ...
-
bioRxiv - Microbiology 2020Quote: ... and dipeptidyl peptidase-4 (DPP4) cDNA clones were obtained from Origene, and cloned into a pcDNA3 vector (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... The Myc-DDK-tagged ORF clone of MAFG (RC221486, OriGene USA) was a gift from I ...
-
bioRxiv - Molecular Biology 2023Quote: ... Pebp1 (MR201759) and Rack1(MR204575) cDNA clones were purchased from Origene, USA ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids containing the following mouse cDNA clones were obtained from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... The Myc-DDK-tagged ORF clone of MAFG (OriGene, Cat. # RC221486) was cloned into pLEGB to replace GFP and create pLEB-MAFG ...
-
bioRxiv - Cancer Biology 2024Quote: ... ORF clones of MAFF and MAFK (OriGene, Cat. # RC215609L3 and #RC223543) were used to replace MAFG in pLEB-MAFG to create MYC-DDK-tagged cDNA expression constructs ...
-
bioRxiv - Neuroscience 2022Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... human Arcn1 with Myc and Flag tags (RC210778, Origene), Flag-APP-C99 was a kind gift from Wenjie Luo (Weill Cornell Medical College) ...
-
bioRxiv - Neuroscience 2022Quote: A plasmid encoding human TrkB was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... Human Cx32 and Rhodopsin cDNA was obtained from Origene and cloned into a pSVL vector (Amersham) ...
-
bioRxiv - Cancer Biology 2021Quote: Human LDHA plasmid was purchased from Origene (MD, USA). Succinylation mutants of LDHA were generated using site-directed mutagenesis kit (GeneAll ...
-
bioRxiv - Immunology 2020Quote: ... HEK293T cells stably expressing GFP-tagged human ACE2 (Origene) were generated using the same methodology ...