Labshake search
Citations for Origene Technologies :
1 - 50 of 630 citations for Human Anti NT5E Recombinant Antibody clone Hu101 28 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified human recombinant NRXN3 TP323448 (Origene) was used as standard ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Cancer Biology 2024Quote: ... recombinant human MTAP was purchased from Origene (MD ...
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
-
bioRxiv - Developmental Biology 2024Quote: Human recombinant oviductin protein was obtained from Origene Technologies Inc ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cancer Biology 2020Quote: ... CXCR4 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Neuroscience 2023Quote: The human GPR37L1 cDNA clone (Origene) was subcloned into pcDNA3.1+ (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and stained with 1:2000 HRP-conjugated anti-human ACE2 (clone OTI1D2, Origene) or 1:5000 HRP-conjugated donkey anti-human IgG (Jackson Immuno Research ...
-
bioRxiv - Molecular Biology 2020Quote: 200 ng of recombinant human Cdt1 (OriGene, Cat #: TP301657) and 20 ng of purified Cyclin A/Cdk1 (Sigma cat ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with 5 μg/ml anti-human FcγRIIa (Origene, clone OTI9G5; 5 μg/ml) in blocking solution at 4°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... Recombinant human NAT10 derived from 293T cells was purchased from Origene Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cell Biology 2021Quote: ... the antibodies used were rabbit monoclonal anti-GLI1 (Clone EPR4523, Origene Technologies) at a 1:1000 dilution and anti-Lamin A/C (Cell Signaling Technologies 2032 ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant human glutaredoxin (Grx) transcript variant 1 was from Origene (cat# TP319385) (Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... two different anti-human DSG2 antibodies (DSG2-Origene, #BM5016; DSG2-Abcam, #ab14415) were used at 1:1000 dilutions in blocking buffer ...
-
bioRxiv - Physiology 2020Quote: ... injected with the same dose of recombinant human NTF3 (OriGene Technologies, Rockville, MD) every day for the first two weeks ...
-
bioRxiv - Cancer Biology 2023Quote: ... The TGF beta 1 (NM_000660) Human Untagged Clone (Origene, SC119746) was used to perform site-directed mutagenesis on residues C355 ...
-
bioRxiv - Cell Biology 2024Quote: ... or BAP31 (BCAP3) Human Tagged Lenti ORF Clone plasmids (Origene) (1µg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following substrates were used in reactions: 0.15 µg of recombinant human Treacle (OriGene), and ~25 nM Pol I or Pol II isolated from S ...
-
bioRxiv - Genetics 2020Quote: ... GJB2 (NM_004004) Human Tagged ORF Clone was purchased from OriGene (RC202092) and Cx30-msfGFP was purchased from Addgene (69019).
-
bioRxiv - Molecular Biology 2024Quote: The human UNG ORF clone was purchased from Origene (Catalog#: RC222868). From this plasmid ...
-
bioRxiv - Neuroscience 2023Quote: TMEM43 Human Tagged ORF Clone (NM_024334.2) was purchased from OriGene (RC200998) and cloned into CMV-MCS-IRES2-EGFP vector using BglII/XmaI sites ...
-
bioRxiv - Immunology 2023Quote: ... CDS of IRF8 from IRF8 human tagged ORF clone (RG217646, Origene) were cloned and digested with BamHD1 and XhoI ...
-
bioRxiv - Immunology 2024Quote: ... The mouse anti-Myc antibody (Clone 9E10, Cat# TA150121, 1:1000) was obtained from OriGene Technologies ...
-
bioRxiv - Genetics 2020Quote: The full-length human BBS2 clone in the pCMV6-entry vector was obtained commercially (Origene; Clone ID: RC204337). Using this as a template ...
-
bioRxiv - Molecular Biology 2023Quote: ... A clone containing the consensus ADAMTS7 coding sequence (NM_014272 Human Untagged Clone) was purchased from Origene (Rockville, USA). To generate Gateway-compatible constructs ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant human Lsm12-expression plasmids were obtained either commercially (pCMV-Lsm12-Myc-FLAG from OriGene) or were constructed with pcDNA6 (pCDNA6-Lsm12-FLAG-His) ...
-
bioRxiv - Biochemistry 2023Quote: Human cell derived recombinant eIF2A-FLAG was expressed in HEK293T cells obtained commercially (OriGene # TP304303) and buffer exchanged into Protein Storage Buffer (25 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... PRB-114P) was from Covance. Mouse monoclonal anti-human JC (clone 3C7, aka OTI3C7) (cat. TA504168) was obtained from OriGene Technologies ...
-
bioRxiv - Biochemistry 2020Quote: The human cDNA clones of LRPPRC and SLIRP were provided by OriGene (product numbers ...
-
bioRxiv - Molecular Biology 2022Quote: ... GTPBP3 (NM_001128855) Human Tagged ORF Clone was purchased from Origene (cat # RC225798).
-
bioRxiv - Neuroscience 2023Quote: We used a pCMV-human TFEB expressing vector from Origene (clone # sc122773), used previously 27 ...
-
bioRxiv - Physiology 2023Quote: ... For human leptin ORF clone (Origene; pCMV-leptin-DDK-Myc; CAT#: RC209259) was used for mutagenizing the AIM sequences ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with Twist (TWIST1) (NM_000474) Human Tagged ORF Clone (Origene). Transfected cells underwent 3 weeks selection procedure with Neomycin (400 µg/ml) ...
-
bioRxiv - Immunology 2022Quote: ... Human MR1 transcript variant 1 (NM_001531) cDNA clone was purchased from Origene. The constructs were then cloned into a lentiviral expression vector with a multiple cloning site separated from GFP reporter via an Internal Ribosomal Entry Site (IRES).
-
bioRxiv - Molecular Biology 2022Quote: 2.5ug Nudt6 Human Tagged ORF Clone (OriGene Technologies, Inc. Rockville, MD, USA) or GFP plasmid respectively were digested with XhoI for 1hr (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... the human HMGCS2 ORF clone with a pCMV6-Entry backbone (Origene, RC208128) was cut and ligated into lentiviral vector (Origene ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-Bcl-xL (clone 4A9, Origene), and β-tubulin (clone TU-06 ...
-
bioRxiv - Bioengineering 2021Quote: Genes encoding NL-Gal3 (IDT, Coralville, IA, USA) and recombinant human Gal3 (OriGene, Rockville, MD, USA) were inserted into pET-21d(+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... We cloned SMPD3 (SMPD3 Human Tagged ORF Clone, Origene Cat#: RG218441, RefSeq-NM_018667.2) and ...
-
bioRxiv - Molecular Biology 2023Quote: The c-Myc tagged human Gab1 cDNA clone (RC209622) was purchased from Origene, USA ...
-
bioRxiv - Cell Biology 2021Quote: rKLK10 (500 ng, described above) was incubated with wild-type human recombinant (rHTRA1) (500 ng, Origene TP322362) or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208 ...
-
bioRxiv - Cell Biology 2024Quote: The following primary antibodies (Ab) were used: anti-afadin mouse monoclonal Ab (mAb) (#AM26175PU-N, clone 3, OriGene; 1:50 dilution for immunofluorescence ...