Labshake search
Citations for Origene Technologies :
201 - 250 of 271 citations for 6 Phenyl piperidine 1 3 dicarboxylic acid 1 tert butyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... the samples were immunostained with the anti-IRSp53/BAIAP2 antibody 1D9 (mouse monoclonal, 1:200, OriGene) and anti-HLA A antibody EP1395Y (rabbit monoclonal ...
-
bioRxiv - Immunology 2023Quote: ... tagged ADA2 was pulled down using 1 µg anti-DDK (FLAG) clone OTI4C5 (#TA50011, OriGene Technologies). An isotype control sample was incubated with 1 µg mouse IgG1 (#02-6100 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary and secondary antibodies were used at the following concentrations: anti-dendra2 1:5000 (OriGene: TA150090), anti-Slack 1:5000 (Aves labs ...
-
bioRxiv - Cancer Biology 2021Quote: We purchased paraffin-embedded sections of prostate specimens from 6 healthy volunteers and 11 patients with prostate cancer (OriGene Technologies). Characteristics of human patients with prostate cancer are summarized in table S3.
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were treated at DIV 3 with AAV1mCherry-pU6-Kv2.1 shRNA designed by OriGene (target sequence ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene, #TA150041); for western blot ...
-
bioRxiv - Cell Biology 2019Quote: ... BMP2K (1-560) and BMP2K (561-1161) were PCR amplified from the template ORF clone # RC215795 (Origene) and inserted into HindIII restriction site of pEGFP-N1 vector using In-Fusion cloning technology (Clontech ...
-
bioRxiv - Cancer Biology 2021Quote: Purified RPRM peptides (77-109, ChinaPeptides; 1 μg) were incubated with purified recombinant CDK4 (Origene; 0.2 μg) and CDK6 proteins (Origene ...
-
bioRxiv - Neuroscience 2021Quote: ... For knockdown experiments four pGFP-C-shLenti vectors containing different shRNAs against Skap2 (Origene; see Table 1) were applied and scrambled shRNA was used as control (OriGene ...
-
bioRxiv - Microbiology 2020Quote: ... human MSR1 (Cat# RC209609) and Beclin 1 (Cat# MR207162) were obtained from Origene (Rockville, MD 20850, USA). pcDNA-FLAG-Ulk1 (Plasmid # 27636 ...
-
bioRxiv - Cell Biology 2022Quote: The full length of human PCDH15-CD1-1 (Q99PJ1, uniport) cloned in pcDNA3.1 was obtained from OriGene. PCDH15-CD2 (Q99PJ1-10 ...
-
bioRxiv - Neuroscience 2022Quote: ... were double immunostained using the following antisera couples: a) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-NUCB2/nesfatin-1 antibody (1:50 ...
-
bioRxiv - Cell Biology 2023Quote: ... EGFP was cloned at the C terminus of the coding sequence of Pitx2 isoform 1 (Origene; MR227617). Lentivirus particles were generated as previously described 69 ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP tagged plasmid with JPh44 translating region (GFP-Δ(1-240) JPh1) were created by OriGene Technologies (Rockville ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm-thick paraffin sections were deparaffinized and stained with anti-human KI67 (1:500, TA802544, Origene), anti-mouse Ki67 (1:800 ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by incubation overnight at 4°C with primary antibodies against GFP (1:100, TP401; OriGene Technologies) (Fig 1B) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Three codons of the shRNA binding site were point mutated without altering the amino acid sequence (Eurofins Genomics, Ebersberg, Germany) and cloned into pCMV6-AC expression vector (Origene, Rockville, MD); the empty expression vector was used as a control ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Microbiology 2024Quote: ... seed in a 6-well plate were transiently co-transfected with 200 ng of a myc-tagged FOS (pCMV6-FOS, OriGene, RC202597) and 600 ng of a wt ORF57 (pVM7 ...
-
bioRxiv - Microbiology 2020Quote: CD4+ 293T cells were transfected with 25 pmol of pooled siRNA (Origene, 3 siRNA per pool) with RNAiMax twice (on day 1 and 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5% heat-inactivated goat serum) and incubated with primary antibody (1:1000 anti-DDK monoclonal 4C5; OriGene Technologies) in PBT1 at 4°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... at 56°C for 40min and re-probed with anti–GFP antibody for 1h (1:1000, Origene R1091P). Band intensity was measured using the histogram function on the Fiji software ...
-
bioRxiv - Immunology 2021Quote: pCMV6-Entry vector encoding Myc-DKK-tagged human wild type (WT) ATAD3A cDNA (NM_018188.4, Q9NV17-1) was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S ...
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Immunology 2022Quote: Lung section slides were also stained with 1 µg/mL rabbit polyclonal anti-NEU1 (TA335236; Origene, Rockville, MD), anti-NEU2 (TA324482 ...
-
bioRxiv - Biophysics 2024Quote: The mouse LRMP construct in PCMV6-Kan/Neo (GenBank AAH52909.1; Cat. #MC228229, Origene, Rockville, MD; Supplementary Figure 1), HCN1 in pcDNA3 (generously provided by Dr ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 CIC OE cells were developed using CIC-Myc-tag plasmid purchased from Origene (CAT#: RC215209). Geneticin (250μg/ml ...
-
bioRxiv - Immunology 2023Quote: The plasmid expressing myc-DDK-tagged wild-type ADA2 (transcript variant 3, NM_001282225) was purchased from OriGene Technologies (#RC238645) ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were generated after transfection with pRS-puro-shWRN (5′-AGGCAGGTGTAG-GAATTGAAGGAGATCAG-3′; sequence ID: TI333414 Origene) and puromycin selection (Palermo et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated with a mixture of primary rabbit anti–GFP antibody (1:500; catalog #SP3005P, OriGene, Rockville, MD) and mouse anti–NeuN antibody (1:1000 ...
-
bioRxiv - Immunology 2019Quote: ... 31) and myc-FLAG-tagged Syncytin-1 and 2 expression constructs in the pCMV6 vector were purchased from Origene. pFR-Luc and pBD-NFkB (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was then incubated overnight at 4°C with a mouse monoclonal anti-mCherry antibody (Origene; 1:1500) diluted in 5% milk in PBS ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... then incubation was undertaken with a primary rabbit polyclonal CSF2RA (GM-CSF receptor alpha) antibody for 1 hour (Origene TA323990S ...
-
bioRxiv - Genomics 2021Quote: ... containing a single guide RNA target sequence 5’-TAGGTCGCCAAAATCCACAC-3’ or the pCas-Guide CRISPR vector (OriGene, KN519669G2) containing a single guide RNA target sequence 5’-CGAGGCGTTTGACCCACCAG-3’ or a combination of the two was transfected into the mouse submandibular salivary gland cell line SIMS using Thermo Fisher’s Lipofectamine 3000 Reagent kit in the following manner ...
-
bioRxiv - Cell Biology 2022Quote: ... 3×106 HEK293T cells were transfected with pLKO_1 (encoding sh_RNAi) or pCMV6-AC (Origene #RG217766, encoding GFP-UHRF1) lentiviral plasmids ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLKO.1-puro or pLKO.1 plasmids encoding target shRNA constructs (Supplemental Table 4; selected from TRC shRNA Library, Broad; purchased from Origene) were cloned as previously described ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-2272) were expressed with a C-terminal Myc-DDK (FLAG) tag from a pCMV6-Entry backbone (#RC218208, Origene, USA) in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... 1 mg of whole-cell extracts (200 μl) were incubated overnight with 1 μg of an anti-flag mouse monoclonal antibody (Origene) at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... we obtained a clone expressing full-length (residues 1-1106) untagged GLI1 in the pCMV6-XL5 vector backbone from OriGene Technologies (catalog number SC125780) ...
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gRNA sequence CTAGAGGAGGAGATCCCGTC (TGG) in exon 1 of ABI1 was cloned into a pCas-Guide-EF1a-GFP vector (cat. #: GE100018) from Origene Technologies (Rockville ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Molecular Biology 2022Quote: A 1.6-kb full length human PAX9 cDNA clone (GeneBank™, accession number NM_006194.1) containing 5’ and 3’ UTRs was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... passage 1 of pHCEnC were transfected with 10 nM anti-SLC4A11 siRNA (CCGAAAGUACCUGAAGUUAAAGAACT) or scrambled siRNA (OriGene Technologies, Rockville, MD, USA) using Lipofectamine LTX (Life Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... For each construct, 1 µg DNA (wt 2N4R tau, N167Q 2N4R tau, N368Q 2N4R tau or AEP (Origene clone no. RC200309)) was used ...
-
bioRxiv - Neuroscience 2020Quote: Neurons were transfected at 12 days in vitro (DIV) with PSD95-GFP (a kind gift from David Bredt [49] and FLAG-tagged Human SRXN-1 (purchased from Origene: RC207654) for 5 h using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2022Quote: ... Cells (1 × 105) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences ...