Labshake search
Citations for Origene Technologies :
1 - 50 of 271 citations for 6 Phenyl piperidine 1 3 dicarboxylic acid 1 tert butyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... and (OriGene, CAT #TA-50011-3, 1:2000) with donkey anti-rabbit HRP and sheep anti-mouse HRP secondaries (1:10000).
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Cancer Biology 2019Quote: Replication incompetent lentivirus were produced in HEK 293T cells co-transfected by mixing 5 µg of either pLKO.1 Empty Vector or pLKO.1 shRNA targeting SMARCD3 with 6 µg Lenti-vpak packaging kit components (OriGene) and 33 µL of transfection reagent (OriGene ...
-
bioRxiv - Cancer Biology 2021Quote: ... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μl Lipofectamine 2000 was mixed with 1 μg of each HA-ZNF804A (Origene, RG211363) or Myc-NT5C2 (Origene ...
-
bioRxiv - Biochemistry 2019Quote: ... the coding region for full-length human GCP2 (amino acids 1-902) was amplified by PCR using its cDNA as template (NM_001256617.1, Origene). The mTagBFP (blue fluorescent protein ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Physiology 2019Quote: ... NRVMs (1 – 3 days post isolation) were transiently transfected with either variant 8 of human BIN1 (AmpII) (Origene Inc, USA) cloned into pCMV6-AC-mKate2 entry vector (Origene Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-HCRTR1 from rabbit (Origene Cat#TA328918; 1:100–1:500). Donkey IgG secondary antibodies coupled to Alexa-594 ...
-
bioRxiv - Neuroscience 2020Quote: ... NDUFAF1 (1:2,000, Origene), TOM20 (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829, Origene, Rockville MD), using PCR primers to add flanking restriction sites ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mouse anti-ZEB2 (Origene, TA802113, IF 1:150, WB 1:2000 in milk), sheep anti-TBR2 (R&D Systems ...
-
bioRxiv - Cell Biology 2020Quote: ... Overexpressed HA-NFATc3 and endogenous Trim39 were detected using anti-HA (1:500) and anti-Trim39 (from Proteintech 1:200, from Origene 1:400) antibodies respectively ...
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Cancer Biology 2019Quote: ... Lgr5 (1:200) (Origene, TA503316), Oct4 (1:200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... LHX1 (OriGene #TA504528; 1:1000); LTL-Biotinylated (Vectorlabs B-1325 ...
-
bioRxiv - Molecular Biology 2022Quote: ... tGFP (1:200 Origene, TA150041), ki67 (Medac 275R-18) ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... β actin (Origene, TA811000, 1:5000), GAPDH (Origene ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... GAPDH (Origene, TA802519, 1:5000), PCNA (BOSTER Biological Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tff1 (OriGene, TA322883 1:100), Tff2 (Proteintech ...
-
bioRxiv - Cell Biology 2021Quote: ... Mcam (Origene, rabbit 1:1000), Mpz (AvesLab ...
-
bioRxiv - Developmental Biology 2022Quote: ... K14 (OriGene, #BP5009, 1:1000), Involucrin (Biolegend ...
-
bioRxiv - Cell Biology 2020Quote: ... tdTomato (1:200, TA180009, OriGene), HuNu (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mcam (Origene, rabbit 1:200), Mpz (AvesLab ...
-
bioRxiv - Cancer Biology 2020Quote: ... ANXA11 (OriGene, 1/100 dilution), PPP1R12A (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... FOXD1 (TA322737, OriGene, 1:50) PAX8 (NBP2-29903 ...
-
bioRxiv - Developmental Biology 2022Quote: ... TRIM24 (1:1000, TA802797, Origene), TRIM33 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... clone 4D6 (Origene, 1:1000), anti-beta-Amyloid ...
-
bioRxiv - Genomics 2023Quote: ... MSX1 (Origene, TA590129, 1:5000), PRRX1 (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-PPP3CB (Origene, 1:200); anti-GRASP65 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... tRFP (OriGene, TA150061, 1:250), GRIA1 (Alomone ...
-
bioRxiv - Cell Biology 2024Quote: ... syntenin (OriGene, TA504796, 1:1000), annexin A1 (Abcam ...
-
bioRxiv - Cancer Biology 2024Quote: ... GAPDH (OTI2D9; 1:5,000; Origene), and Actin (JLA20 ...
-
bioRxiv - Neuroscience 2024Quote: ... SETD7(1:500, TA503322, Origene), and GAPDH (1:2,000 ...
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Bioengineering 2023Quote: ... Sections were then developed using the respective Polink-2 Plus HRP with DAB kit (Origene, D87-6 Hamster D39-6 Rabbit). Sections were counterstained in Hematoxylin (EMS ...
-
bioRxiv - Neuroscience 2021Quote: ... Paralemmin (1:1,000, Acris-OriGene TA335984), Plasticity related protein-1 (1:1,000 (WB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... NY-ESO-1 recombinant protein (Origene) at 0.5 ug/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... Hexokinase II (TA325030, 1:500, Origene), Glut1 (ab115730 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-tGFP (1:1000 Origene, TA150041) GAPDH (1:2000 Millipore ...
-
bioRxiv - Physiology 2022Quote: ... anti-tGFP (TA150075, 1:500; Origene), anti-CoxIV (ab33985 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-K14 (1:300, Origene #BP5009) and anti-GFP (6 μg/ml ...