Labshake search
Citations for American BioInnovations, :
251 - 300 of 323 citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... PCR reaction was performed in a thermal cycler (Veriti® 96-Well Thermal Cycler, ABI Biosystems, USA) as published in Maduranga et al.[23] ...
-
bioRxiv - Microbiology 2023Quote: ... PowerUp SYBR Green Master Mix was then used for qRT-PCR reactions using Second Step instrument (ABI). Transcriptional levels of genes were normalized to 16S rRNA ...
-
bioRxiv - Microbiology 2023Quote: ... PowerUp SYBR Green Master Mix was then used for qRT-PCR reactions using Second Step instrument (ABI). Transcriptional levels of genes were normalized to GAPDH.
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative PCR was conducted using designed primers with the primerdb database and PowerUp SYBR Green Master Mix (ABI) in QuantaStudio (ABI) ...
-
bioRxiv - Immunology 2023Quote: ... 2 μl of cDNA were added to 23 μl of PCR mixture containing 2xSYBR Green Master Mix (ABI) and 0.2 μM of forward and reverse primers ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Quant-iT PicoGreen dsDNA Assay Kit (ABI), First Strand cDNA Synthesis Kit (Servicebio) ...
-
bioRxiv - Epidemiology 2019Quote: ... The PCR-positive amplicons were directly sequenced with an automated DNA sequencer (ABI PRISM 373; Perkin-Elmer, Norwalk, CT). Sequence analysis was carried out using a FASTA search on the Genbank database ...
-
bioRxiv - Neuroscience 2021Quote: ... We performed qPCR using 1 μL of cDNA with 7.60 µl of Taqman Universal PCR Master Mix (with No Amperase UNG, ABI) and 0.75 µl of miRNA-specific PCR TaqMan MicroRNA probes (20X ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR products were run on an ABI 3730xl Genetic Analyzer and marker genotype was determined in GeneMapper® (ABI). All individuals were sacrificed with an overdose of MS-222 ...
-
bioRxiv - Neuroscience 2019Quote: ... The PCR products were cleaned up by ExoSAP-IT Express and analyzed by Sanger sequencing (ABI 3130, Applied Biosystems).
-
bioRxiv - Molecular Biology 2020Quote: ... All PCR reactions were performed in duplicate in 96-well plates on a StepOne System (ABI Prism, Applied Biosystems). Each reaction contained 5 μL fast Sybr Green ...
-
bioRxiv - Genetics 2020Quote: ... followed by PCR amplification (ncoa3CRISPR F: FAM-ATGAATGAGCAAGGCCACAT; ncoa3CRIPSR R: GGACTTGCTCCCATTTTAGG) and subjected to fragment length analysis (ABI 3500) to test gRNA efficiency (90% efficiency rate detected) ...
-
bioRxiv - Molecular Biology 2020Quote: ... CD44 and CD24 - was undertaken by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) of total RNAs using an ABI7300 thermal cycling system (ABI) and the SsoAdvance SYBR green mixture (Bio-Rad) ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative RT-PCR was performed on cDNA using either TaqMan primers and probes or QuantiTect primers in combination with TaqMan PCR Master Mix (ABI) or SYBR Green chemistry and reactions were run on a RT-PCR system (QuantiStudio 6 Flex ...
-
bioRxiv - Plant Biology 2023Quote: ... by using the HieffTM qPCR SYBR Green Master Mix (Low Rox Plus, cat no. 11202ES08, Yeasen, Shanghai, China) on a QuantStudio 6 Flex PCR (ABI). The qPCR signals were normalized to those of the reference gene PST in pine trees ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purified PCR products were submitted for sequencing at the University of Florida DNA Sequencing Core Laboratory (ICBR, Gainesville, Florida) using standard fluorescent cycle-sequencing PCR reactions (ABI Prism Big Dye terminator chemistry ...
-
bioRxiv - Plant Biology 2024Quote: ... with Hieff™ qPCR SYBR Green Master Mix (Low Rox Plus, cat no. 11202ES08, Yeasen, Shanghai, China) on a QuantStudio 6 Flex PCR system (ABI). The qPCR signals were normalized to those of the reference gene PST in Pinus by applying the 2-ΔΔCT method (Fang et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... High capacity cDNA synthesis kit (ABI cat#4368813), TaqMan qPCR primer probe set ABI ...
-
bioRxiv - Genomics 2020Quote: The purified cDNA or dsDNA samples were assayed by quantitative PCR with ABI ViiA 7 and Power SYBR Green Master Mix (ABI 4368706) using custom designed primers (Additional file 3 ...
-
bioRxiv - Genetics 2022Quote: ... The gene-specific primers of the Pm69 and the housekeeping gene Ubiquitin were used for qRT-PCR amplification performed on a StepOne thermal cycler (ABI, USA) in a volume of 10 μl containing 5 μl of SYBR Green FastMix (Quantabio ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were verified by 2% agarose electrophoresis gel and subjected to sequencing by using a 3730XL DNA Analyzer (ABI, USA).
-
bioRxiv - Neuroscience 2021Quote: ... we used High-Capacity cDNA Reverse Transcription kit (ABI) with RNAses inhibitors to reversely transcribed RNA into cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... the BigDye Teminator V3.1 Cycle Sequencing Kit (ABI, USA) was used to extract the total DNA of strain D ...
-
bioRxiv - Zoology 2019Quote: ... and Big dye terminator sequencing kit (ABI Prism, USA), and a 614 base pairs length of 5 sequences of cytochrome c oxidase subunit 1 (COI ...
-
bioRxiv - Neuroscience 2019Quote: ... with ten-fold dilution of cDNA and 200 nM of each primer using the SYBR Select PCR Master Mix (ABI, Thermo Fisher). Primers are listed in Table S1 ...
-
Quantitative three-dimensional nondestructive imaging of whole anaerobic ammonium-oxidizing bacteriabioRxiv - Cell Biology 2019Quote: ... The V3-V4 regions of the anammox 16S rRNA gene were amplified with the primer 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and the primer 806R (5’-GGACTACHVGGGTWTCTAAT-3’) using polymerase chain reaction (PCR) (ABI GeneAmp 9700). The PCR program was as follows ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of each replicate was analyzed by nested quantitative PCR (45 cycles of 95 C for 15 seconds and 60 ℃ for 1 minute) using Fast Advanced Master Mix (ABI Life Technologies) in an ABI StepOnePlus Real-Time PCR machine ...
-
bioRxiv - Neuroscience 2020Quote: ... High Capacity cDNA Reverse Transcription Kit (#4368814) was from ABI/Thermo (Waltham ...
-
bioRxiv - Immunology 2022Quote: ... The hypervariable region V3-V4 of the bacterial 16S rRNA gene was amplified with primer pairs 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by an ABI Gene Amp® 9700 PCR thermocycler (ABI, CA, USA). The PCR reaction mixture included 4 μL 5× Fast Pfu buffer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1-10 ng template in 9 μl Nuclease-free water were added to 10.0 μL of 2× TaqMan® Universal PCR master mix (ABI/Life technologies, USA) and 1.0 μL of a 20× combined primers and probes mix (ABI/Life Technologies ...
-
bioRxiv - Genomics 2022Quote: ... and gene expressions of apoLp and POA3-like after male feeding on dsRNAapoLp were evaluated by qRT-PCR analysis (ABI StepOne Plus, Foster, CA) using TB Green Premix Ex Taq II (Catalog No ...
-
bioRxiv - Cancer Biology 2024Quote: ... the libraries were quantified (KAPA Library Quantification Kit (Illumina/ABI Prism), normalized ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative PCR was performed using TAQMAN gene expression master mix of equivalent amounts of total cDNA for forty cycles (ABI GeneAmp 9700 DNA thermal cycler). Endpoint data was assembled by comparison of Delta-Ct values for HN1 versus corresponding GAPDH Delta-Ct values for each cell line ...
-
bioRxiv - Neuroscience 2020Quote: ... We used the High Capacity cDNA Reverse Transcription Kit (#4368814) from ABI/Thermo Fisher per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesised using the High Capacity RNA-to-cDNA kit (ABI) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Reverse transcription was performed using a highcapacity RNA-cDNA kit (Applied Biosystems [ABI]) with 1 μg RNA per 20 μL reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... cDNA was generated using the High-Capacity cDNA Reverse Transcription Kit (ABI, # 4368814).
-
bioRxiv - Molecular Biology 2023Quote: ... Complementary DNA was produced using the High-Capacity cDNA Reverse Transcription kit (ABI) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (ABI). Power SYBR Master Mix (ABI ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was prepared using 10 µL RNA (High Capacity cDNA Reverse Transcription kit, ABI). The Light Cycler 480 probe master kit (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription reaction was carried out using High Capacity cDNA Reverse Transcription Kit (ABI), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Ex-protein fractions using TaqMan microRNA Reverse transcription kit (ABI 4366597 Lot#00636931), TaqMan miRNA stem-loop RT primers/qPCR primer probe set (ABI 4427975) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription was carried out using High-Capacity cDNA Reverse Transcription Kit (ABI, 4368814) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and RISC-Poor (36-47) using TaqMan microRNA Reverse transcription kit (ABI 4366597 Lot#00636931), TaqMan miRNA stem-loop RT primers/qPCR primer probe sets (ABI 4427975 ...
-
bioRxiv - Neuroscience 2021Quote: ... for reverse transcription with the High-Capacity cDNA Reverse Transcription Kits (ABI Applied Biosystems, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher, ABI 4368814). PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... and reverse transcription was performed using a high-capacity RNA-cDNA kit (Applied Biosystems [ABI]) with 1 μg RNA per 20 μl reaction ...
-
bioRxiv - Immunology 2019Quote: ... or whole blood (PAXgene Blood RNA Kit) and reverse-transcribed (ABI High Capacity Reverse Transcriptase). The expression of ISGs (IFIT1 ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was obtained by reverse transcription using the High-capacity cDNA Reverse Transcription Kits (ABI). Samples were analyzed by real-time PCR with GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was obtained by reverse transcription using the High-capacity cDNA Reverse Transcription Kits (ABI). Samples were analyzed by real-time PCR with LightCycler Taqman Master (Roche ...