Labshake search
Citations for American BioInnovations, :
151 - 200 of 323 citations for ssc mir 758 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... reactions were carried out in biological triplicate with QuantiTect SYBR Green Master Mix using an Applied Biosystems StepOne Plus real-time machine (ABI). Results were analyzed using the ΔΔCT method ...
-
bioRxiv - Microbiology 2024Quote: ... All the results were normalised against β-actin expression using the Thermal Cycler Dice Real Time System (ABI QuantStudio6, Singapore).
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative real-time PCR reactions were carried out in technical triplicate with QuantiTect SYBR Green Master Mix using Applied Biosystems StepOne Plus real-time machine (ABI). Results were analyzed using ΔΔCT method ...
-
bioRxiv - Microbiology 2019Quote: ... Viral miRNA expression was normalized to cellular miR-16 levels (Assay ID 000391; ABI). For quantitation of miRNA copy number in infected CD34+ HPCs ...
-
bioRxiv - Cell Biology 2021Quote: ... All real-time PCR was carried out with Power SYBR Green PCR master mix on the ABI prism 7900 HT sequence detection system (ABI) as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: Assays using the GPS™ COVID-19 dtec-RT-qPCR kit (Alicante, Spain) were prepared and reaction mixtures were subjected to qPCR in a QuantStudio3 (ABI) as described in the manual provided ...
-
bioRxiv - Cancer Biology 2021Quote: ... The RT-qPCR data were analyzed with DataAssist (ABI) and Rest 2009 software (Qiagen) ...
-
bioRxiv - Immunology 2019Quote: ... A 7000-sequence detection system (ABI Prism, Applied Biosystems®) was used through the SYBRGreen kit (Applied Biosystems® ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting PCR products were sequenced directly using the Big Dye Terminator Cycle Sequencing kit (ABI) and the ABI 377 sequencer.
-
bioRxiv - Cell Biology 2019Quote: ... the cDNA template was amplified (ABI PRISM 7900HT Sequence Detection System) with gene-specific primer sets using the Platinum Quantitative PCR SuperMix-UDG with ROX (11743-100 ...
-
bioRxiv - Neuroscience 2020Quote: ... was performed on a sequence detection system (Prism Model 7500; ABI) using the ΔΔCT method ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed in the ABI sequence Detector System (ABI Prism 7000 Sequence Detection System and software ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR reactions were performed using Fast Sybr Master Mix (ABI) on a ViiA7 Real-Time PCR system ...
-
bioRxiv - Plant Biology 2020Quote: Quantitative PCR (ABI Prism 7300 Sequence Detection System ...
-
bioRxiv - Molecular Biology 2020Quote: ... TaqMan miRNA stem-loop RT primers/qPCR primer probe sets (ABI 4427975) (cel-miR-39 ID# 000200 Lot#P180110-003B10 ...
-
bioRxiv - Microbiology 2020Quote: ... Ninety-six-well microplates for RT-qPCR analysis were purchased from ABI Applied Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR was performed in triplicate and data were collected by ABI STEPONETM software version 2.1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... TaqMan miRNA stem-loop RT primers/qPCR primer probe set (ABI 4427975): (cel-miR-39 ID# 000200 Lot#P180110-003B10 ...
-
bioRxiv - Molecular Biology 2022Quote: ... We performed quantitative PCR using PowerSYBR Green PCR Master Mix (ABI, 4367659) with three technical replicates in 384-well plates using the QuantStudio 5 Real-Time PCR machine ...
-
bioRxiv - Biochemistry 2021Quote: ... respectively on an Applied Biosystems Vii7 RT-qPCR instrument (ABI, Vernon, CA, USA). Table 1 presents the primer sequences ...
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCR was performed using an SYBR Premix on a StepOne Plus machine (ABI). Relative gene expression was analyzed using the 2-Ct method with Arbp as an internal control ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR products were cloned into the PCR®-Blunt II-TOPO vector (ABI, USA) and confirmed by sequencing.
-
bioRxiv - Microbiology 2021Quote: ... was amplified and detected by SYBR Green PCR Master Mix kit (bao bio-engineering Co., Ltd, China) on the ABI7500 instrument (ABI, USA). For qRT-PCR reactions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and PCR Master Mix (ABI) with Power SYBR Green (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... The Quantitative PCR Q6 (ABI) was used for real-time PCR ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... PCR amplification instrument (ABI, 2720), enzyme labeling instrument (BioTek ...
-
bioRxiv - Immunology 2019Quote: ... Relative quantification of probes levels was calculated (7500 Sequence Detection System Software Version 1.4, ABI). Few samples were genotyped by using primers (forward ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR products were purified from agarose gels and Sanger sequenced with the IGHV primers used for PCR and the BigDye Sequencing Kit (ABI, Heidelberg, Germany) on an Applied Biosystems 3130 Genetic Analyzer (ABI) ...
-
bioRxiv - Neuroscience 2021Quote: ... qRT-PCR was performed by ABI QuantStudio3 machine (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... ABI 2720 PCR amplify instrument (ABI); FLX800T type enzyme labelling instrument (BioTek Proton Instrument Co. ...
-
bioRxiv - Molecular Biology 2019Quote: ... Power SYBR Green PCR Master Mix (Fermentas, Canada) was used in the qRT-PCR analyses (ABI-7500FAST). The relative mRNA level was calculated based on the average Ct value of the target gene and the Alu reference [2-(Cttarget_gene-CtAlu)] [49].
-
bioRxiv - Microbiology 2019Quote: ... All qRT-PCR experiments were performed using Thermo Fisher’s Power Sybr Green PCR Master Mix (4367659; ABI) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... DNA fragment detection with 1bp resolution was performed with an automated DNA sequencer (ABI 3130, Applied Biosystems) and size determination was obtained with GeneMapper 4.1 (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... For RT-qPCR, SYBR Green (Vazyme, China) was used with the StepOne Plus system (ABI, MA, USA). The 2−ΔΔCt method was used to estimate the relative expression levels ...
-
bioRxiv - Synthetic Biology 2021Quote: ... A 60 s heat shock was done by a PCR machine (ABI Veriti 96 well PCR Thermal Cycler) at 42°C ...
-
bioRxiv - Immunology 2021Quote: ... PCR amplification was performed in the presence of SYBR green in a 7500 Fast Realtime PCR System (ABI). Specific primers were designed with Primer Express 2.0 (Applied Biosystems) ...
-
bioRxiv - Genetics 2019Quote: ... Quantitative reverse transcription PCR (qRT-PCR) was performed in triplicate for each sample on a Viia7 instrument (ABI) using Power SYBR Green PCR Master Mix (Invitrogen) ...
-
bioRxiv - Biochemistry 2021Quote: ... q-PCR amplification was performed by ABI 7900HT fast real-time PCR system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... SYBR Green PCR Master Mix (ABI 4309155) was used for cDNA amplification in a real-time fluorescence quantitative PCR instrument (ABI ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative PCR (qPCR) was performed by ABI Quant Studio 3 series PCR machine (Applied Biosystem ...
-
bioRxiv - Neuroscience 2021Quote: ... The protocol followed the manufacturer’s recommendations with the exception of using 2 μl for each RT primer (ABI) in a 10 μl total reaction volume (i.e. ...
-
bioRxiv - Cell Biology 2022Quote: ... qRT-PCR reactions were performed with the TOYOBO SYBR Green Realtime PCR Master Mix (TOYOBO) and analyzed with a step-one Plus PCR system (ABI). Lotus Ubiquitin (Lj5g3v2060710.1 ...
-
bioRxiv - Immunology 2021Quote: ... in a 7500 Fast Realtime PCR System (ABI). Specific primers were designed with Primer Express 2.0 (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Probes for quantititative PCR were purchased from ABI: hypoxanthine-guanine phosphoribosyl transferase 1 (HPRT ...
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR reaction system (ABI QuantStudio 3) included ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR was performed on an Applied Biosystems (ABI) 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’ ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... PCR was performed using ABI7900HT (ABI Company, USA) according to established methods ...
-
bioRxiv - Genetics 2023Quote: ... qRT-PCR was performed (ABI-Q6, California, USA) in a 20 µL reaction ...
-
bioRxiv - Microbiology 2023Quote: ... PE5700 automatic fluorescent quantitative PCR analyzer (ABI, USA); CKX41 inverted microscope (Olympus ...
-
bioRxiv - Neuroscience 2020Quote: ... Each ChIP sample and a range of dilutions of the corresponding input sample (0.01 – 2% input) were quantitatively analyzed with gene-specific primers using the 7500 detection system (ABI) and SYBR qPCR Premix (Clontech) ...