Labshake search
Citations for ChromoTek :
351 - 400 of 1610 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... rat anti-RFP (Chromotek, 5F8, 1:1000), rabbit anti-RFP (MBL ...
-
bioRxiv - Cancer Biology 2023Quote: The PCNA-chromobody (PCNA-CB-RFP) (Chromotek, ccr) was purchased with a material transfer agreement from Chromotek ...
-
bioRxiv - Cancer Biology 2023Quote: ... was purchased with a material transfer agreement from Chromotek. It was transiently transfected in nAC-GFP stable U2OS cells with Lipofectamine 3000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... mNeonGreen monoclonal mouse antibody (Chromotek, #32f6-100), p300 monoclonal mouse antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Plant Biology 2023Quote: ... Immunoprecipitation was then performed with GFP-Trap beads (ChromoTek, gtma-20), using 50 μL GFP-Trap beads for around 6 mg proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... The signal of mCherry and GFP was enhanced using a rat mAb anti-RFP (Chromotek, 5f8-100) and a rabbit pAb anti-GFP antibody (BIOZOL/MBL ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl) and then incubated with GFP-nAb Magnetic Agarose beads also known as GFP-Trap (Allele Biotech or Chromotek), EZview Red Anti-HA Affinity Gel (Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... Spot tag (ChromoTek, Planegg-Martinsried, Germany), TOMM22 (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti-RFP (Chromotek, 5F8) 1:2000.
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant fractions were collected and subjected to GFP-IP using GFP-Trap beads (Chromotek). The GFP-Trap beads (15µL beads suspension per reaction ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were left on ice for 30 minutes and centrifuged at 16,000 g for one hour at 4 °C and the protein was captured with 25 μL Myc-trap (Chromotek) beads by tumbling overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... mEGFP-mAID-NIPBL and SCC1-mEGFP were detected and visualised with an anti-GFP nanobody booster (Chromotek, gba488-100, 1:250).
-
bioRxiv - Molecular Biology 2023Quote: ... mNeonGreen (1:500; Chromotek, 32f6). Coverslips were mounted using anti-fade reagent Prolong Gold containing DAPI (Life Technologies) ...
-
bioRxiv - Plant Biology 2023Quote: ... or the RFP-Trap Magnetic Particles (Chromotek) and µMACS Columns (Miltenyi Biotec) ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP-IPs were carried out using 40 μL GFP-Trap Agarose beads (ChromoTek, gta-20). Mock IPs were carried out using an equivalent volume of protein G Sepharose beads ...
-
bioRxiv - Plant Biology 2023Quote: ... polyclonal rabbit anti-GFP (1:3,000; pabg1, Chromotek) followed by polyclonal goat anti-mouse IgG-HRP (1:7,500 ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining lysate was incubated with GFP-Trap® magnetic beads (ChromoTek) as previously described for 45 min at 4°C on a rotary mixer [14] ...
-
bioRxiv - Plant Biology 2023Quote: ... The lysates were incubated with GFP-Trap magnetic beads (Chromotek) at 4°C for 2 h ...
-
bioRxiv - Neuroscience 2023Quote: GFP was immunoprecipitated with GFP-Trap (Chromotek) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-Trap MA beads (Chromotek, Ref. gtma-20), Bio- Beads™ SM2 adsorbent media (Biorad ...
-
bioRxiv - Molecular Biology 2023Quote: ... Co-Immunoprecipitation was performed according to the manufacturers’ instructions using GFP-Trap® Beads (Chromotek) and ANTI-FLAG® M2 Beads (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-RFP (1:1000, rat monoclonal, 5F8 ChromoTek or 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... The samples were then incubated overnight at +4°C with the primary antibody (rabbit anti-GFP, 1:600, Chromotek) diluted in the blocking solution ...
-
bioRxiv - Biochemistry 2023Quote: For creation of cells stably expressing plasmids containing EGFP-SNM1A or a Chromobody® of RFP-PCNA (Chromotek), ∼5 x 105 cells were seeded in wells of a 6-well plate and immediately transfected with the desired plasmid (2.6 µg ...
-
bioRxiv - Developmental Biology 2023Quote: ... The CUT and TAG experiment was done for two biological replicates using antibodies anti-GFP (Chromotek, PABG1-100, 1:50), anti-YFP (Merck Millipore ...
-
bioRxiv - Plant Biology 2023Quote: ... Lysates were precleared with 50 µL of sepharose beads for 1 h at 4°C with constant rotation and subjected to immunoprecipitation with 25 µL GFP Trap agarose beads (Chromotek, gta-20) during 1 h at 4°C with constant rotation ...
-
bioRxiv - Plant Biology 2023Quote: ... the chromatin was treated with ultrasound and the DNA fragments were precipitated using GFP-TRAP Magnetic Agarose beads (Chromotek, gtma-20). After protein digestion ...
-
bioRxiv - Plant Biology 2023Quote: ... Lysates were precleared with 200 µL of sepharose beads for 1 h at 4°C under constant rotation and then subjected to immunoprecipitation with 50 µL of GFP Trap agarose beads (Chromotek, gta-20) for 2 h at 4°C under constant rotation ...
-
bioRxiv - Plant Biology 2023Quote: ... benthamiana leaves and pulldown assay were carried out according to102 with the following modifications: For immunoprecipitation of GFP-tagged proteins 50 µl of GFP-Trap magnetic beads (Chromotek, Planegg-Martinsried, Germany) were washed 3 times with extraction buffer and incubated for 2 h at 4 °C with 500 µl of a total protein extract containing a protease inhibitor cocktail (1x cOmplete™ ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysates were incubated end-over-end with GFP-TrapA beads (ChromoTek) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatant was incubated with magnetic agarose GFP-Trap beads (Chromotek) for 2 h at 4°C with end-to-end rotation ...
-
bioRxiv - Plant Biology 2023Quote: ... Anti-c-myc beads (VF299569, Thermo) or RFP-Trap Magnetic Agarose (Chromotek) were added to the protein extracts and incubated at 4°C for 3 h ...
-
bioRxiv - Plant Biology 2023Quote: ... cell lysates were incubated with GFP-trap beads (ChromoTek) at 4°C overnight ...
-
bioRxiv - Plant Biology 2023Quote: ... polyclonal rabbit anti-GFP (1:3,000; pabg1, Chromotek) followed by polyclonal goat anti-mouse IgG-HRP (1:7,500 ...
-
bioRxiv - Plant Biology 2023Quote: ... (2021) using 15 μl α-GFP-magnetic beads (Chromotek). Anti-GFP antibody (sc9966) ...
-
bioRxiv - Biophysics 2023Quote: ... GFP-Trap beads (Chromotek) were incubated with MB buffer supplemented with 5 mg ml-1 BSA overnight at 4 ℃ to minimize non-specific binding ...
-
bioRxiv - Neuroscience 2023Quote: ... and rat anti-RFP (ratRFP; Chromotek; 1:1000) were used to enhance the signal of GFP and RFP ...
-
bioRxiv - Systems Biology 2023Quote: ... The proteins were immunoprecipitated using GFP-Trap (Chromotek) according to manufacturer’s protocol (with slight modifications) ...
-
bioRxiv - Plant Biology 2023Quote: ... seedling lysates were incubated with GFP-trap beads (Chromotek). After washing away all non-binding proteins ...
-
bioRxiv - Plant Biology 2023Quote: ... RFP (Chromotek, 6g6) or HA (Agrisera ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse anti-RFP (Chromotek, 6G6) (diluted ...
-
bioRxiv - Immunology 2023Quote: The coding sequence of the Dnmt1-chromobody targeting the human Dnmt1 protein [37] (Uniprot : P26358 · DNMT1_HUMAN) and lamin-chromobody (ChromoTek) targeting the lamin D0 from Drosophila monogaster (Uniprot ...
-
bioRxiv - Microbiology 2023Quote: ... the parasite lysates were combined with mNeonGreen-Trap Magnetic Agarose (ChromoTek) and were incubated with rotation at 4°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit anti-V5 (Chromotek 14440-1-AP), and mouse anti-V5-HRP (Sigma V2260).
-
bioRxiv - Microbiology 2023Quote: V5 proteins were captured using V5 trap agarose beads (Chromotek v5ta). The following antibodies were used for western blot analysis ...
-
bioRxiv - Immunology 2023Quote: ... The plasmid encoding the actin-chromobody (ChromoTek) was used to amplify the coding sequence of the chromobody under the control of the T7 promoter with actin-chromobody-for AATTAATACGACTCACTATAGGGAGAAAGGAGATATCCATGGCTCAGGTGCAGCTGGTGG and chromobody-RFP/GFP-rev TTATGATCTAGAGTCGCGGCCGC.
-
bioRxiv - Molecular Biology 2023Quote: ... GFP-Trap® beads (Chromotek)) were used to isolate GFP-tagged proteins ...
-
bioRxiv - Microbiology 2023Quote: ... Protein extracts were incubated with GFP-Trap (ChromoTek) beads for 1h at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... Extracts were then treated with The DYDDDDK Fab-Trap™ agarose beads (ChromoTek, Proteintech) and the retained Flag-tagged FlaA/B was eluted from the agarose beads using 3xFLAG®-peptide (Chromotek ...
-
bioRxiv - Microbiology 2023Quote: ... and the retained Flag-tagged FlaA/B was eluted from the agarose beads using 3xFLAG®-peptide (Chromotek, Proteintech). For the co-IP of GlfM from S ...