Labshake search
Citations for Invivogen :
101 - 150 of 413 citations for SARS CoV 2 Spike N Terminal Domain NTD Sheep Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The cDNAs were fused to the C terminus of human IgG1-Fc in the expression vector pFuse-hIgG1-Fc2 (InvivoGen). Constructs containing Clec12a or empty vector were transfected into Lx293 cells cultured with DMEM +10% FBS and Pen/strep (1mg/mL) ...
-
bioRxiv - Immunology 2023Quote: ... These Gibson sequences are necessary for cloning of the VH and VL into our rabbit IgG1 expression vectors which are based on the pFUSE-rIgG-Fc (InvivoGen) vectors.75,76 For this second PCR ...
-
bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... or on solid YPD-agar (1% yeast extract, 2% peptone, 2% D-glucose, 2% agar) and selected with 100 µg/ml Zeocin® (InvivoGen). For small scale expression screening ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 S1-614D and S1-614G tagged with human IgG Fc fragment were constructed by insertion of the S1 region (residues 1-681) to pFUSE-hIgG1-Fc1 vector (InvivoGen, USA) and expressed using the Expi293 Expression system (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% FCS and 5 µg/ml plasmocin prophylactic reagent (InvivoGen, Cat.: ant-mpp) at 37 °C/5% CO2 to induce better melanin production ...
-
bioRxiv - Developmental Biology 2019Quote: ... followed by selection using 2 μg/ml of puromycin (Invivogen, 58-58-2) for 2–3 days starting from 2 days after infection ...
-
bioRxiv - Biochemistry 2024Quote: ... a fragment of recombinant DNA encoding either residues 21 to 220 of human CD44 or 25 to 224 of murine CD44 were subcloned into an in-house Fc pFUSE-based vector (Invivogen, pfuse-hg1fc1) with a Gly/Ser linker in between ...
-
bioRxiv - Immunology 2022Quote: ... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
bioRxiv - Microbiology 2022Quote: ... A549 lung carcinoma cells expressing human ACE2 and human TMPRSS2 (A549.ACE2+.TMPRSS2+; cat n° a549-hace2tpsa, Invivogen) were grown in DMEM/10% FBS supplemented with 100 µg/ml Normocin ...
-
bioRxiv - Immunology 2022Quote: ... or Alum (Alhydrogel 2%, InvivoGen) at 50% v/v at final volume of 30µl per dose ...
-
bioRxiv - Immunology 2020Quote: ... R848 (2 μg/mL, InvivoGen), CHIKV-LR at a multiplicity of infection (MOI ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 2% Primocin (Invivogen) at 4°C and transported on ice to be processed within 24 hours for organoid culture ...
-
bioRxiv - Molecular Biology 2023Quote: ... THP-1 Null 2 (InvivoGen), THP-1 Null 2 NLRP3 KO (InvivoGen ...
-
bioRxiv - Biochemistry 2023Quote: ... puromycin (2 µg/ml, InvivoGen), blasticidin (10 µg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 2% Primocin (Invivogen) at 4°C and transported on ice to be processed within 24 hours for organoid culture ...
-
bioRxiv - Immunology 2024Quote: ... and heavy and light chain variable sequences were synthesized as single chain variable fragments (ScFvs) containing a interchain (Light-Heavy) G4S3 linker and cloned into a pFuse-hG1-Fc2 Fc-tagged vector (InVivoGen, San Diego, CA), in-frame between the vector supplied signal sequence (from the human Il-2 protein ...
-
bioRxiv - Immunology 2022Quote: ... N = 3) were immunized with a mixture of 50 μg each of H1ssF and H10ssF formulated with AddaVax (Invivogen) in 1 ml via intramuscular route at weeks 0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... while zeocin was added at 800μg/ml for counter selection of stable transfected cells (InvivoGen, cat n°ant-zn1). Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by 2,5 μM BV6 (Selleckchem) pre-treatment (SK-N-AS cells only) and treatment with 10 μg/ml poly(I:C) (Invivogen). Human TNF-α (600 lU/ml ...
-
bioRxiv - Immunology 2022Quote: ... 2′3′-RR c-di-AMP (2′3′-RR-S2 CDA) (Invivogen cat. no. tlrl-nacda2r), 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP ...
-
bioRxiv - Cell Biology 2020Quote: ... and doxycycline (Invivogen, 2 mM stock) were dissolved in water.
-
bioRxiv - Pathology 2019Quote: ... 0.5mL primocin (Invivogen ant-pm-2), BDNF (10ng/mL ...
-
bioRxiv - Microbiology 2020Quote: ... with Primocin (InvivoGen, ant-pm-2), and then digested with Collagenase II (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... Blasticidin selection (2 μg/ml, InvivoGen) was started 2–4 days after plating of cells and picking of clones was started 10–14 days after nucleofection ...
-
bioRxiv - Bioengineering 2021Quote: ... and Alhydrogel adjuvant 2% (alum, InvivoGen) were used for vaccination studies ...
-
bioRxiv - Genomics 2021Quote: ... and 2 mg/ml puromycin (InvivoGen) were added 24h after infection ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... and normocin (ant-nr-2, Invivogen). We used the Flp-InTM-CHO to generate CHO-derived stable transgenic cell lines overexpressing either MANF or its mutants from a transcriptionally active locus ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μg/mL puromycin (Invivogen) at 37°C and 5% CO2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µg/ml of puromycin (InvivoGen) was added to select for infected cells ...
-
bioRxiv - Immunology 2020Quote: ... 2) lipopolysaccharide (LPS) (10ng/ml - InvivoGen); and 3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and doxycycline (Invivogen, 2 mM stock) were dissolved in water ...
-
bioRxiv - Cell Biology 2023Quote: ... 1X primocin (Invivogen, ANT-PM-2), 1X N2 and B27 supplements (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... 1X normocin (Invivogen, ANT-NR-2), 1X primocin (Invivogen ...
-
bioRxiv - Immunology 2023Quote: ... 2′-3′cGAMP was from InvivoGen, human recombinant sTREM2 was from Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... abbreviated P3CSK4 (2 pg/mL; Invivogen), or recombinant IFN-β (400 U/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Puromycin (2 μg/mL, InvivoGen), depending on the selection cassette present in the enhancer plasmid ...
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... or 2’-3’cGAMP (4µg/ml, Invivogen) for the specified times ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with 2 μg/ml puromycin (InvivoGen), 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... or 2 μg ISD (InvivoGen, CA, USA) by lipofectamine 2000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... 2 μg of either poly-IC (Invivogen), 5’-ppp RNA (Invivogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... selective inhibitor of JAK1/2 (10uM) (Invivogen), and Butylated hydroxylanisole (BHA) ...
-
bioRxiv - Immunology 2020Quote: ... and NOD1/2 inhibitor GEF (Gefitinib, Invivogen) were added to the cell cultures along with either solution buffer (control ...
-
bioRxiv - Microbiology 2022Quote: ... and poly I:C (2 µg/ml, InvivoGen) to facilitate the presentation of long peptides by antigen presenting cells (Schuhmacher et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.2% Primocin (InvivoGen, ant-pm-2) at a density of 12,000 cells/cm2 on the coated coverslips for neurite outgrowth and for synaptic analyses 24,000 cells/cm2 ...
-
bioRxiv - Microbiology 2023Quote: ... β-D-ADP-heptose (2 mM, Invivogen) and β-L-ADP-heptose (J&K ...
-
bioRxiv - Immunology 2023Quote: ... 2 μg/mL LPS (tlrl-peklps, InvivoGen), 10 ng/mL IL-4 (574302 ...