Labshake search
Citations for Invivogen :
101 - 150 of 151 citations for IL 4 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: 20 µg/mouse poly(I:C) (HMW) VacciGrade™ (Invivogen, San Diego, CA, USA) and 20 µg/mouse 3pRNA (synthesized by AG Hartmann ...
-
bioRxiv - Cell Biology 2023Quote: ... incubated with a human-mouse hybrid aCD20 (InvivoGen hcd20-mab10, 5 ng/ml), added to wells at 40,000 cells per well ...
-
bioRxiv - Immunology 2024Quote: ... ODN1826 and ODN2395 were from a mouse TLR9 agonist kit (Invivogen, tlrl-kit9m). Poly(I:C ...
-
bioRxiv - Immunology 2021Quote: ... mice were injected subcutaneously (beside the tumor) with 50 μg/mouse poly(I:C) (Invivogen) together with antigenic peptides (for Pmel-1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Wako Chemicals) and rat anti-mouse Clec7a (activated microglia; 1:50; InvivoGen, CA, USA) in 2% NDS and PBS-T for 1 hour at 4°C ...
-
Vaccinia virus-based vaccines confer protective immunity against SARS-CoV-2 virus in Syrian hamstersbioRxiv - Immunology 2021Quote: ... boost 4 weeks later of 5 μg recombinant spike protein (aa 14-1209) in 1% alhydrogel (Invivogen) into the right hind limb ...
-
bioRxiv - Microbiology 2020Quote: ... thuringiensis-infected mice was intravitreally treated with the synthetic TLR2/4 inhibitor OxPAPC (Invivogen; 30 ng/μl) (WT+OxPAPC ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were selected 24 h post infection in 4 µg/ml Blasticidin (Invivogen, ant-bl-1) or 100 µg/ml of hygromycin (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... mice were primed by intraperitoneal injection of low molecular weight Poly(I:C) (LMW, InvivoGen; 4 mg/kg) followed 6h later by intraperitoneal challenge with LPS (L2630 ...
-
bioRxiv - Immunology 2020Quote: ... Mouse bone marrow-derived macrophages (BMDMs) treated with 0.5 μg/ml LPS (tlrl-smlps, Invivogen) for 3 h followed by 5 mM ATP (10519987001 ...
-
bioRxiv - Neuroscience 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). Neurons infected with GCaMP6f as stated above were infected with AAV9-hSyn-Cre (Addgene #105553-AAV9 ...
-
bioRxiv - Immunology 2022Quote: The following in vivo treatment regimens were used in this study: DMXAA (5,6-dimethylxanthenone-4-acetic acid, Invivogen): 20mg/Kg intraperitoneal (i.p.) ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). For calcium imaging experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa Cyclin B1-GFP cells were grown in media containing 4 μg/ml blasticidin (Invivogen # ant-bl-05). HeLa Cyclin A2-GFP cells 25 were grown in media containing 9 μg/ml blasticidin (gifts of Francis Barr) ...
-
bioRxiv - Immunology 2022Quote: 50μg biotinylated NS1 protein or 50μg (4-hydroxy-3-nitrophenyl)-acetyl(15)-OVA (NP-OVA) was adsorbed to 100μg alhydrogel alum (InVivoGen) in a total of 200μL per mouse for 30 min at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... we administered plasmid DNA adjuvanted with 20 μg/mouse monophosphoryl lipid A from Salmonella minnesota (Invivogen) via the i.m ...
-
bioRxiv - Immunology 2020Quote: ... WGP-S and WGP-D (500 μg/mouse for in vivo experiments) were purchased from Invivogen; diphtheria toxin (unnicked ...
-
bioRxiv - Molecular Biology 2023Quote: ... partial mouse Azin1 expression plasmids were transfected using Lipofectamine 2000 in the presence of NATETM (InvivoGen) in some experiments.
-
bioRxiv - Biochemistry 2021Quote: PMA-differentiated THP1 macrophages in 24-well plates were pretreated with fatty acids (2.5 μM and 10 μM) for 30 min prior to stimulation with 4 μg/mL cGAMP (InvivoGen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl UV-treated sample was inoculated onto 4×104 cells/ well of HEK-Blue IFNα/β cells (InvivoGen) in 96-well plates ...
-
bioRxiv - Immunology 2023Quote: ... Culture supernatants from THP-1 Dual cells (20 µl) were mixed with QUANTI-Luc 4 Lucia/Gaussia reagent (Invivogen), and luminescence was measured by a luminometer ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
bioRxiv - Immunology 2020Quote: ... Animals received 1 μg of the TLR-2 ligand Pam3Cys-Ser-(Lys)4 trihydrochloride (Pam3Cys) (Invivogen, San Diego, CA, USA), 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp. ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Microbiology 2022Quote: ... Eluted fractions were analyzed by western blotting with a mouse monoclonal RBD-specific antibody (InvivoGen, Cat# srbdmab10). Peak fractions were then pooled and dialyzed against PBS in 10,000 molecular weight cutoff (MWCO ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Omicron Variant (B.1.1.529/BA.1) pLV-SpikeV11) and Omicron Variants (BA.4/BA.5) pLV-SpikeV13) were purchased from InvivoGen (San Diego, CA). The human T-Cell lymphoma Jurkat (E6-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-ppp-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (Catalog Code, lyec-12, InvivoGen), following the manufacturer’ ss instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... supernatant was harvested and IFN levels were quantified by Lumikine mouse IFN luminescent ELISA (Invivogen, Cat# luex-mifnbv2) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Eluted fractions were analyzed by western blotting with a mouse monoclonal RBD specific antibody (InvivoGen, Cat# srbd-mab10). Peak fractions were then pooled and dialyzed against PBS in 10,000 molecular weight cutoff (MWCO ...
-
bioRxiv - Physiology 2023Quote: Mouse FGL1 cDNA sequences (full length, N-terminal domain, globular domain) were cloned into pFUSEN-hG2Fc plasmid (InvivoGen) with the following modifications ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (ant-pm-1, InvivoGen, San Diego, California, USA). Cultures were incubated at 37°C ...
-
Mapping of the autophagosomal degradome identifies IL-7Rα as key cargo in proliferating CD4+ T-cellsbioRxiv - Immunology 2021Quote: ... total splenocytes isolated from OT-II mouse spleens were cultured with OVA 323-339 peptide (1 mg/ml, InvivoGen) and recombinant murine IL-2 (20 ng/ml ...
-
bioRxiv - Bioengineering 2023Quote: ... fused with the cDNA sequence of the mouse hinge and IgG2a heavy chain Fc region (pFUSE-mIgG2a-Fc1, InvivoGen), downstream of a mouse Ig kappa chain secretion signal peptide and was subcloned into a pMSGV retroviral vector followed by enhanced (e)GFP reporter gene cassette using PCR and standard molecular cloning techniques to generate pMSGV-A4-Fc-T2A-eGFP ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... Rnh1 was excised in Rnh1fl/fl Mx1-Cre+ mouse model by giving three rounds of 200 μg poly(I:C) (Invivogen) using intraperitoneal injections once every two days ...
-
bioRxiv - Microbiology 2021Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM cyclic di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM c-di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes.
-
bioRxiv - Cancer Biology 2023Quote: ... All cells were routinely confirmed to be negative for mycoplasma infection every 3–4 months using PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Microbiology 2020Quote: ... Soluble Fc-mDectin-1a containing the C-terminal extracellular domain of mouse Dectin-1a fused with the human IgG1 Fc domain was purchased from Invivogen. Overnight C ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse colonic organoids were maintained in maintained in advanced DMEM/F-12 supplemented with 1X Primocin (Invivogen #ant-pm-1), 10mM HEPES ...
-
bioRxiv - Immunology 2023Quote: ... alongside 100 μg mIgG1 anti-CD40 mAb (3/23, mouse IgG1 generated in-house as described previously[29, 30]) and the indicated doses of DMXAA(Invivogen), ADU-S100 was obtained from Oxeltis(Montpellier ...
-
bioRxiv - Immunology 2022Quote: ... indicated dose of conjugated or free SOSIP proteins (25 μg mi3-conjugated SOSIP per mouse in most experiments) were mixed with 20 μg MPLA (Invivogen, vac-mpls) and 10 μg Quil-A (Invivogen ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 or 8 µg/ml) or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...