Labshake search
Citations for Invivogen :
51 - 100 of 428 citations for 26S Proteasome Non ATPase Regulatory Subunit 10 PSMD10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... or 10 µg/ml blasticidin (InvivoGen). Single cells were sorted by FACS and propagated to create monoclonal lines ...
-
bioRxiv - Immunology 2023Quote: ... 10 μM nigericin (tlrl-nig; InvivoGen), 1 μM MCC950 (17510 ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 µg/mL of blasticidin (Invivogen) and 200 µg/mL of hygromycin (Invivogen ...
-
bioRxiv - Immunology 2023Quote: ... and 10 µg Quil-A (Invivogen) via subcutaneous injection on day 0 and 21 ...
-
bioRxiv - Systems Biology 2021Quote: ... 10% U.S Origin FBS (GenClone #25-514) with 10 μg/mL hygromycin B ([Invivogen ant-hg-1). Cells were cultured in T-25 ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfected cells were selected 24 h after transfection with either 10 μg·mL-1 Blasticidin S or 10 μg·mL-1 G418 (both InvivoGen). Gene disruptions were confirmed either by immunoblotting (forB- and forG- ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 10 µg/mL of blasticidin (InvivoGen).
-
bioRxiv - Immunology 2019Quote: ... and Poly(I:C) (10 μg/ml; InvivoGen) for 2 days ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 μg/ml poly(I:C) (HMW, Invivogen) or 1 μg/ml LPS (from Escherichia coli strain 0127:B8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 10 μg ml-1 blasticidin (InvivoGen) and independent clones obtained by limiting dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μg mL-1 of Blasticidin (Invivogen) and 1000 μg mL-1 G418 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... selecting with 10 μg/ml blasticidin (InvivoGen) and 2 μg/ml puromycin (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... 10-15 µg mL-1 G418 (InvivoGen), 50 µg mL-1 hygromycin (InvivoGen ...
-
bioRxiv - Microbiology 2020Quote: ... and puromycin at 10 µg/ml (InvivoGen).
-
bioRxiv - Immunology 2020Quote: ... and 10 µg monophosphoryl Lipid A (InVivogen) diluted in 1X Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10 μg/mL blasticidin (Invivogen) to maintain TMPRSS2 expression ...
-
bioRxiv - Immunology 2020Quote: ... CpG2006 (TLR9; tlrl-2006; Invivogen, 10 μM), Flagellin (TLR5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... LPS (10 μg/mL, InvivoGen tlrl-eblps), ssDNA (1 μg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... or blasticidin (InvivoGen, 5 ∼ 10 µg/ml), as appropriate.
-
bioRxiv - Immunology 2022Quote: ... and 10 µg/mL of blasticidin (InvivoGen). MDBK-t2 cells were seeded into 24-well plates at 1 × 105 / well and incubated at 37°C in a 5% CO2 incubator overnight ...
-
bioRxiv - Immunology 2022Quote: ... OVA + CpG (10 μg, Invivogen, Cat# ODN1826) and OVA + Alum (200 μg Sigma ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg/mL Ac-YVAD-cmk (Invivogen), 5 µg/mL RU.521 (Invivogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... and/or 10 μg/ml blasticidin (InvivoGen). Expression of double-stranded RNA was induced by adding 1 μg/ml tetracycline (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 5-10 μg/ml blasticidin S (Invivogen) or FACS ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 10 ug/mL blinatumomab (InVivoGen, # bimab-hcd19cd3) in PBS was added to CD19 probes for 1h ...
-
bioRxiv - Bioengineering 2024Quote: ... and 10 μg saponin (InvivoGen, vac-quil) in PBS ...
-
bioRxiv - Systems Biology 2023Quote: ... the cells were trypsinized and transferred to a 10 cm dish containing DMEM supplemented with 10% FBS and 200 µg/ml hygromycin B (Invivogen) for selection ...
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... wildtype C57BL/6 were immunized by intraperitoneal injection of 5 µg Spike protein (5 µg, Bio-Techne) in presence of 10 µg CpG adjuvant (10 µg, ODN1826, Invivogen), followed by two reimmunization steps of 5 µg Spike protein in 10 µg CpG adjuvant every 15 days for a total of three immunizations.
-
bioRxiv - Neuroscience 2021Quote: ... Puromycin (Invivogen 10 mg/ml, ant-pr-1) selection with 0.2 µg/ml in E8 medium started two days after transfection ...
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2021Quote: ... 10 μg of OVA (Cat: VAC-POVA, Invivogen) and 8 μg of CpG (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Immunology 2020Quote: ... and 10 μg of ODN 1826 (CpG, Invivogen) resuspended in sterile phosphate buffered saline (PBS) ...
-
bioRxiv - Immunology 2020Quote: ... R837 (TLR7; tlrl-imqs; Invivogen, 10 μg/ml), and R848 (TLR7/8 ...
-
bioRxiv - Immunology 2019Quote: ... PAM3CSK4 (10 ng/ml, InvivoGen, San Diego, CA), (6 ...
-
bioRxiv - Neuroscience 2019Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Cell lysis and RNA extraction were performed 24h post-activation using Nucleospin RNA extraction kit (Macherey-Nagel) ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hours and 10 μM nigericin (InvivoGen) for an additional 1 hour ...
-
bioRxiv - Physiology 2019Quote: ... or the PI3K inhibitor wortmannin (10 μM; InvivoGen) to inhibit Akt activation for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... mice were injected with 10 µg LPS (InvivoGen), 5 µg CGRP (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μg/ml Blasticidin (InvivoGen; BLL-38-02A) were added to the medium of WI38 fast for sgRNA plasmid selection in cell cycle arrest treatment assay (Fig 5) ...
-
bioRxiv - Neuroscience 2021Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Purity after isolation was evaluated by FACS analysis with anti-CD14-FITC (Miltenyi) ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μg Quil-A (Invivogen, vac-quil) in PBS for a total volume of 250 μl for each mouse ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µmol Y-27632 Rock inhibitor (InvivoGen, USA), and 200 µg/ml Geneticin (Gibco ...
-
bioRxiv - Immunology 2022Quote: HEK-BlueTM IL-10 (InvivoGen Cat#hkb-il10) and IFNγ (InvivoGen Cat#hkb-ifng ...
-
bioRxiv - Systems Biology 2023Quote: ... selection began with 10 μg/mL blasticidin (InvivoGen). Cells were maintained in log growth conditions each day by diluting cell concentrations back to a 5 × 105 cells/mL (and replenishing blasticidin) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and IL-10 cells were purchased from Invivogen (catalog no ...
-
bioRxiv - Immunology 2023Quote: ... depleted zymosan (10 μg /mL, InvivoGen tlrl-zyd), Pam3CSK4 (100 ng/mL ...