Labshake search
Citations for Invivogen :
1 - 50 of 428 citations for 26S Proteasome Non ATPase Regulatory Subunit 10 PSMD10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... 26 μg/ml Primocin (ant-pm-1, InvivoGen), and conditioned medium from the L cell line secreting Wnt3A (50% of total volume ...
-
bioRxiv - Systems Biology 2020Quote: ... Non-transduced cells were eliminated by selection with 10 μg mL−1 blasticidin (Invivogen). Selection was maintained until non-transduced controls reached 0% viability twice in succession (~ ten doublings) ...
-
bioRxiv - Systems Biology 2021Quote: ... interferon regulatory factor (IRF)-activity was assayed using QUANTI-Luc™ luminescence reagent (InvivoGen, San Diego, CA, USA) and an INFINITE 200 PRO microplate reader (Tecan ...
-
bioRxiv - Cell Biology 2019Quote: ... 1% Non-essential amino acids (BioInd.) and 0.1mg/ml Primocin (InvivoGen).
-
bioRxiv - Cell Biology 2019Quote: ... 1% Non-essential amino acids (BioInd.) and 0.1mg/ml Primocin (InvivoGen). IVND included 3 steps ...
-
bioRxiv - Immunology 2019Quote: ... 5 μg/ml rat anti-human polyclonal antibody to TLR2 was reconstituted per manufacturer directions and added to basolateral chambers containing 10 μg/ml zymosan (Invivogen, PAb-hTLR2).
-
bioRxiv - Systems Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination using cells cultured in non-antibiotic medium (PlasmoTest Mycoplasma Detection Assay, InvivoGen).
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Bioengineering 2021Quote: ... 10 µg MPLA (Invivogen), 20 µg CpG ODN 1826 (Invivogen) ...
-
bioRxiv - Immunology 2021Quote: ... MCC950 (10 μM; Invivogen) 20 minutes before SMAC mimetic treatment.
-
bioRxiv - Immunology 2019Quote: ... Rapamycin (10 nM; InvivoGen) was used for blocking mTOR mediated signal transduction ...
-
bioRxiv - Immunology 2021Quote: ... 10 μM nigericin (InvivoGen) for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10% fetal bovine serum (FBS) and 10 µg/mL Hygromycin B (InvivoGen) at 37°C in 5% CO2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The transfection mix was applied to the cells for six hours then removed and replaced with lentiviral collection media: DMEM + 10% FBS(HyClone) + 1.1% BSA + HEPES (10 mM) + sodium pyruvate (10 mM) + Primocin (Invivogen ant-pm-1). The lentivirus was collected in two batches at 48 and 72 hours and pooled together ...
-
bioRxiv - Microbiology 2019Quote: ... Primary antibodies used: Mouse anti-HA antibody (InvivoGen, 1:1000), rabbit anti-ACP (1:2000) ...
-
bioRxiv - Microbiology 2022Quote: ... and GFP1-10 were maintained in DMEMc supplemented with blasticidin (10 μg/mL, InvivoGen), puromycin (1 μg/mL ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μg/ml blasticidin (Invivogen) were added to the culture medium for one week ...
-
bioRxiv - Immunology 2021Quote: ... 10 ng/ml FSL1 (InvivoGen), and 50 ng/ml flagellin (InvivoGen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and nigericin (10 μM, Invivogen), or fibrillar α-synuclein (10 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... blasticidin (10 μg/mL; Invivogen), or combinations thereof ...
-
bioRxiv - Neuroscience 2019Quote: ... puromycin (10 μg/ml, Invivogen) was added (NOCL3 ...
-
bioRxiv - Immunology 2019Quote: ... PAM3CSK4 (10 ng/ml, InvivoGen), (7 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg/ml Blasticidin (Invivogen) was used to select for cells that had incorporated pXPR_120 into their genome ...
-
bioRxiv - Physiology 2019Quote: ... or wortmannin (10 μM; InvivoGen). Following a 16 hour overnight incubation ...
-
bioRxiv - Immunology 2020Quote: ... Imiquimod (10 μg/mL, Invivogen), or CpG-B ODN1826 (10 μg/mL ...
-
bioRxiv - Immunology 2020Quote: ... Pam3CSK4 (10 ng/mL) (Invivogen), FSL-1 (10 ng/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... blasticidin (10 μg/mL; InvivoGen) and puromycin (1 μg/mL ...
-
bioRxiv - Immunology 2022Quote: ... or 10 nM bafilomycin (InvivoGen), or DMSO alone (or other concentration of drug where indicated) ...
-
bioRxiv - Biochemistry 2023Quote: ... blasticidin (10 µg/ml, InvivoGen) and phleomycin (2.5 µg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µg/mL Blasticidin (Invivogen), and 100 µg/mL Hygromycin B (GoldBio) ...
-
bioRxiv - Cell Biology 2024Quote: ... LeptomycinB (InvivoGen #inh-lep-10) dissolved in ethanol was used at 20nM final concentration in 100mM sucrose supplemented F-12K medium.
-
bioRxiv - Immunology 2019Quote: 10 μg/ml zymosan (Infigen) and 10 μg/ml peptidoglycan from Staphylococcus aureus (PGN, Invivogen) were added to monolayer or basolateral chamber of ALI cultures on days 10-14 ...
-
bioRxiv - Immunology 2020Quote: ... Mice were immunized via subcutaneous injection of 10 µg antigen with 10 µg Quil-A (InVivogen) and 10 µg monophosphoryl Lipid A (InVivogen ...
-
bioRxiv - Cell Biology 2020Quote: ... and 10 μg/ml Blasticidin (Invivogen). Single clones resistant to both drugs were then isolated and analyzed by PCR on genomic DNA and immunoblotting for PAF1 to confirm homozygous AID tagging ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... and 10 μg/ml blasticidin (Invivogen) was supplied to select for cells that had incorporated pXPR_120 into their genome ...
-
bioRxiv - Immunology 2022Quote: ... 10 μg/ml of blasticidin (Invivogen) and 100 μg/ml of Zeocin™ (Invivogen) ...
-
bioRxiv - Microbiology 2022Quote: ... and blasticidin (10 μg/ml) (Invivogen). The exogenous expression of ACE2 and TMPRSS2 in the HEK293-C34 cells was induced by addition of doxycycline hydrochloride (1 μg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 µg/mL blasticidin S (Invivogen) was used over 12 days to establish a stable cell line expressing Utr230-EN ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 μg/ml Balsticidin (InvivoGen, USA) and 50 μg/ml Zeocin (InvivoGen ...
-
bioRxiv - Neuroscience 2021Quote: ... dexamethasone (Invivogen, 10 μM, 24 h).
-
bioRxiv - Cell Biology 2020Quote: ... or 10 μg/ml blasticidin (InvivoGen)) was started 24 h after the last infection and continued for one week.
-
bioRxiv - Synthetic Biology 2020Quote: ... and 10 μg/mL zeocin (InvivoGen). Single-cell clones were isolated by the limiting dilution method.
-
bioRxiv - Synthetic Biology 2020Quote: ... 10 μg/mL blasticidin S (InvivoGen), 1.0 μg/mL puromycin (InvivoGen) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 10 µg/mL blasticidin (InvivoGen). One day prior to production ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μg/ml of blasticidin (Invivogen) and 100 μg/ml of Zeocin™ (Invivogen).Caco-2 and Calu-3 cells were stimulated for 24 h with media containing TLR4 agonist Lipopolysaccharide (LPS ...
-
bioRxiv - Immunology 2020Quote: ... FSL-1 (10 ng/mL) (Invivogen), or CDTa and CDTb (5 ng/mL each ...
-
bioRxiv - Genetics 2022Quote: ... MycoStrip™ (InvivoGen, rep-mys-10) did not detect mycoplasma contamination in any of the cell cultures used in this study.
-
bioRxiv - Microbiology 2022Quote: ... 10 μg/ml of blasticidin (InvivoGen), and penicillin-streptomycin (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... cGAMP (10 μg ml-1, Invivogen), poly-I:C (5 μg ml-1 ...
-
bioRxiv - Bioengineering 2023Quote: AddaVax™ (Invivogen, vac-adx-10), a squalene-based oil-in-water nano-emulsion ...