Labshake search
Citations for Invivogen :
2051 - 2100 of 2334 citations for Sodium Monofluoroacetate 90% Cp 13C2 99%; 2 2 D2 98% 1 Mg Ml In Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... or hygromycin (100 μg.ml-1, InvivoGen, pNDH-OCT). After 5 days at 20 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... THP-1 cells (THP1-dual cells from InvivoGen) were maintained in RPMI 1640 (with 2 mM L-glutamine ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: THP-1 ISRE reporter cells (InvivoGen, thpd-nfis) were seeded in 384-well plates with 5,000 cells per well in a total of 30 μL of full medium containing RPMI 1640 (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... ssRNA40 was complexed with LyoVec (lyec-1, Invivogen) for 30min at RT before stimulation according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Puromycin was purchased from InvivoGen (#ant-pr-1). The Spike S1 Neutralizing Antibody (Clone#G10xA1 ...
-
bioRxiv - Immunology 2023Quote: ... or caspase-1 inhibitor Ac-YVAD-cmk (InvivoGen) were added at indicated concentrations 30 min prior to treatment with DENV2 NS1 or nigericin.
-
bioRxiv - Cancer Biology 2023Quote: ... and Normocin™ (1X) (InvivoGen, ANT-NR-1). Tissue was then digested with 1 mL of enzyme-free dissociation agent HyClone™ (GE Healthcare Life Sciences ...
-
bioRxiv - Immunology 2023Quote: THP-1-ASC-GFP cells (InvivoGen, CA, USA) were maintained according to manufacturer’s instructions using RPMI 1640 and 10% FBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... To analyze the interferon response HEK-Dual hTLR3 cells were treated with 5 μg/ml poly(I:C) HMW (InvivoGen) or the different extracted media for four hours ...
-
bioRxiv - Cell Biology 2020Quote: ... HeLa Flp-In TRex cells expressing GFP-Astrin variants cells were maintained in medium supplemented with 200μg/ml Hygromycin B (Invivogen) and 4μg/ml Blasticidin (Invivogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... while zeocin was added at 800μg/ml for counter selection of stable transfected cells (InvivoGen, cat n°ant-zn1). Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen ...
-
bioRxiv - Microbiology 2021Quote: ... H7-T7-IZ cells were maintained in a DMEM completed medium supplemented with 50 µg/ml of Zeocin (InvivoGen) and used for transfection of the T7 promoter-driven pTM expression vectors ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing the respective shRNA sequences (shINTS3: GCTGTGACCTCATTCGCTACA, shINTS6: ACCACTAATGATTCGATAATA, shINTS7: GCAGTAAAGAGACTTGCTATT) and 2.5 µg/ml puromycin (InvivoGen, #ant-pr) selection ...
-
bioRxiv - Microbiology 2020Quote: ... using the calcium phosphate precipitation technique and selected by treating the cells with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2022Quote: ... cells were washed for 5 minutes in PBS and incubated into PBS 1X with 1.67ug/mL of DAPI (Invivogen). Cells were washed for 5 minutes in PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... were cultured in RPMI 1640 medium (GibcoBRL Technologies) with 10% heat-inactivated FBS and 100 μg/mL Zeocin (InvivoGen). NuFF-1 cells (GlobalStem ...
-
bioRxiv - Microbiology 2022Quote: ... cells were transfected with 100 ng/ml of the RIG-I agonist 5’ triphosphate hairpin RNA (3p-hpRNA, Invivogen) complexed to Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... and MHC-I blocking antibody (W6/32; 50 ug/ml) in RPMI supplemented with human serum and primocin (Invivogen). Cells were harvested and stained with anti-CD3 FITC antibody (UCHT1 ...
-
bioRxiv - Immunology 2020Quote: ... and cells were stimulated with 100 μl milk EVs or EV-depleted controls in the presence or absence of 5 μg/ml Poly I:C (Invivogen). After 4 or 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were subjected to a selection process by maintaining in the medium in a presence of desired selection reagent (1μg/ml Blasticidin (#ant-bl, Invivogen), 400μg/ml Zeocin (#ant-zn ...
-
bioRxiv - Cell Biology 2019Quote: ... the cells were subjected to a selection process by maintaining in the medium in a presence of desired selection reagent (1μg/ml Blasticidin (#ant-bl, Invivogen), 1μg/ml puromycin (#ant-pr ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by 2,5 μM BV6 (Selleckchem) pre-treatment (SK-N-AS cells only) and treatment with 10 μg/ml poly(I:C) (Invivogen). Human TNF-α (600 lU/ml ...
-
bioRxiv - Microbiology 2020Quote: ... Transduced HCT116cas9 cells were selected for 10 days and maintained in growing medium supplemented with 10μL/mL of Blasticidin (Invivogen).
-
bioRxiv - Biochemistry 2021Quote: PMA-differentiated THP1 macrophages in 24-well plates were pretreated with fatty acids (2.5 μM and 10 μM) for 30 min prior to stimulation with 4 μg/mL cGAMP (InvivoGen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... Stable transfectants were obtained according to the manufacturer’s instructions by homologous recombination at the FRT were selected using 100 μg/ml Hygromycin B Gold (Invivogen). All live imaging was performed in Leibovitz’s L-15 medium (Gibco ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... they were subjected to a selection process by maintaining them in the presence of a suitable selection reagent (1μg/ml blasticidine [#ant-bl, Invivogen] ...
-
bioRxiv - Immunology 2021Quote: ... the cells were pre-incubated for 30 min at 37°C with 5 μg/mL of anti-TLR2 monoclonal antibody (clone T2.5, InvivoGen) or with an isotype control (mIgG1 ...
-
bioRxiv - Immunology 2020Quote: ... detached with a cell scraper and resuspended at a density of 2.8 × 105 cells/mL in HEK-Blue Detection media (Invivogen). Neutralizing antibodies against TLR2 ...
-
bioRxiv - Genomics 2021Quote: ... 50,000 PBMCs from each individual were incubated for 10 hours at 37C and 5% CO2 in either the presence or absence of LPS (0.1 ug/mL, Invivogen ultrapure LPS from E ...
-
bioRxiv - Genomics 2020Quote: ... These 4T1 cells were always kept in selection medium containing 10 µg/mL of blasticidin (ant-bl-05, Invivogen). When reaching 70% confluency ...
-
bioRxiv - Immunology 2022Quote: ... Positive control stimulation of microglia was also performed by the addition of LPS (100 ng/mL; Invivogen tlrl-b5lps) and ...
-
bioRxiv - Immunology 2022Quote: 293T STING-mNG spCas9 were transduced with SEC24C or ATP6V1G1 sgRNAs cloned in CROPseq-Guide-Puro and selected with 2µg/ml Puromycin (Invivogen) for one week ...
-
bioRxiv - Immunology 2022Quote: 293T were transduced with pTRIP-UbC-Blast-2A-STING-mNeonGreen(mNG) and selected with 15µg/ml of Blasticidin (Invivogen) for one week ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were incubated for 30 min at room temperature (RT) and 0.2 µg/ml of Fc-h-dectin-hFc (Invivogen) was added to the UV-irradiated conidia and incubated for 1 h at RT ...
-
bioRxiv - Immunology 2023Quote: ... and 10% FCS in a 96 well ‘U’ bottomed plate and stimulated with 1μg/mL LPS-EB Ultrapure (Invivogen) and Brefeldin A (eBioScience) ...
-
bioRxiv - Immunology 2023Quote: ... 5000 B cells were then cultured in the presence of 50,000 sorted B220-cells and with 1ug/mL R848 (tlrl-r848, InVivoGen) and anti-CD40 (clone FGK4.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... Stable populations of puromycin-resistant cells were obtained by selecting in 1ug/mL puromycin (Invivogen, San Diego, CA, USA) for at least 48hrs.
-
bioRxiv - Microbiology 2023Quote: ... cells were trypsinized and seeded into 100 mm dishes and selection was initiated with 10 μg/ml blasticidin (Invivogen) and 200 μg/ml hygromycin B (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and post-transduction selection was conducted over ten days with 10 µg/mL of Blasticidin (Invivogen, ant-bl-05) supplementation in TYK-nu media ...
-
bioRxiv - Cell Biology 2023Quote: ... and then in plating media composed of 10% FBS in DMEM/F12 (SH30023.01, Cytiva) with 100 µg/mL Primocin (ant-pm, InvivoGen). Cells were then passed through a 70-µm cell strainer (258368 ...
-
bioRxiv - Microbiology 2024Quote: ... and diluted to 2.5 x 105 cells/ml in complete RPMI with 100 nM phorbol 12-myristate 13-acetate (PMA) (InvivoGen) to differentiate cells to a macrophage phenotype ...
-
bioRxiv - Cell Biology 2024Quote: ... Transduced clones were selected and maintained in a medium containing 20 μg/ml Blasticidin S (Invivogen, #ant-bl-05).
-
bioRxiv - Genomics 2024Quote: ... THP1-ASC-GFP-Cas9 CASP1/8KO Brunello-iT7 cells were pre-differentiated overnight with 100 ng/ml PMA (Invivogen). The next day ...
-
bioRxiv - Cancer Biology 2022Quote: ... Puromycin (ant-pr-1) was purchased from Invivogen (France). The ATP Determination Kit (10700345 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Necrostatin-1 and Z-VAD were purchased from Invivogen. Bay 11-7085 and SB202190 were purchased from Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... and selected with blasticidin S (InvivoGen, ant-bl-1) and hygromycin B (InvivoGen ...
-
bioRxiv - Immunology 2021Quote: ... Protein vaccines were administered with 1:10 AdjuPhos (Invivogen).
-
bioRxiv - Immunology 2022Quote: ... 50ug of CpG ODN 1826 (Invivogen #tlrl-1826-1) was adsorbed onto 3ug linear 25K PEI (Polysciences 23966 ...
-
bioRxiv - Cancer Biology 2022Quote: VX765 was purchased from InvivoGen (Cat# inh-vx765i-1) and used at a concentration of 10μM ...
-
bioRxiv - Immunology 2022Quote: ... or NLRP3 blockage using compound MCC950 (1 μM, InvivoGen).