Labshake search
Citations for Invivogen :
1851 - 1900 of 2334 citations for Sodium Monofluoroacetate 90% Cp 13C2 99%; 2 2 D2 98% 1 Mg Ml In Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... HA-IPS-1(MAVS) (Invivogen), IFN-β-luc (Michael Gale ...
-
bioRxiv - Cell Biology 2022Quote: ... Blasticidin (InvivoGen, ant-bl-1), Geneticin (G-418 ...
-
bioRxiv - Cancer Biology 2019Quote: ... cGAMP (InvivoGen, 1 × 25 μg) was injected i.t ...
-
bioRxiv - Immunology 2021Quote: ... with 1 μM CL097 (Invivogen), 100 ng/mL LPS (Invivogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Puromycin (InvivoGen, ant-pr-1), Blasticidin (InvivoGen ...
-
bioRxiv - Immunology 2022Quote: ... 333 nM Torin 1(Invivogen), 100n M Wortmannin (Invivogen ...
-
bioRxiv - Immunology 2022Quote: ... 333 nM Torin 1 (Invivogen) or Torin 1+Bafilomycin A1 ...
-
bioRxiv - Cell Biology 2023Quote: ... hygromycin (ant-hg-1, Invivogen), kanamycin (BP906-5 ...
-
bioRxiv - Cell Biology 2023Quote: ... puromycin (ant-pr-1, Invivogen), sodium chloride (6438 ...
-
bioRxiv - Cell Biology 2023Quote: ... blasticidin (ant-bl-1, Invivogen), Bortezomib (10008822 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Primocin (Invivogen, ant-pm-1) and Penicillin-Streptomycin-Amphotericin-B (Biological industries ...
-
bioRxiv - Immunology 2023Quote: THP-1-Dual cells (InVivoGen) were grown under selection media at 37°C according to manufacturer’s instruction ...
-
bioRxiv - Physiology 2023Quote: ... and 1:500 Normocin (InvivoGen).
-
bioRxiv - Immunology 2023Quote: ... THP-1 (Invivogen, thpd-nfis), U937 (ATCC ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1:500 Primocin (Invivogen). After digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... Puromycin (Invivogen, ant-pr-1). The following antibodies were used ...
-
bioRxiv - Genomics 2023Quote: ... blasticidin (ant-bl-1, Invivogen).
-
bioRxiv - Cancer Biology 2023Quote: ... 1 v/v% normocin (Invivogen), 50 ng/ml EGF (Peprotech) ...
-
bioRxiv - Immunology 2023Quote: ... THP-1 Dual cells (Invivogen) were maintained in RPMI1640 supplemented with 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... puromycin (#ant-pr-1; InvivoGen) was added at a final concentration of 1 µg/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... + 1:5000 Primocin® (Invivogen), which specifically facilitates the outgrowth of basal cells ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg/μL primocin (InvivoGen), and 20 mM HEPES ...
-
bioRxiv - Immunology 2024Quote: ... Puromycin (Invivogen, ant-pr-1), Sytox Orange (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... were prepared for immunization via dilution in PBS and mixed 1:1 with Alhydrogel (Invivogen). For all single antigen immunizations ...
-
bioRxiv - Neuroscience 2023Quote: ... Rat neutralizing monoclonal anti-mDECTIN-1-IgG (clone R1-4E4) (Invivogen mabg-mdect, 1:30); Rat monoclonal anti-CD206 (clone MR5D3 ...
-
bioRxiv - Cell Biology 2020Quote: ... After 48 hrs the cells were selected with 10 µg/ml blasticidin (InvivoGen, ant-bl) for 7 days ...
-
bioRxiv - Molecular Biology 2021Quote: HEK cell lines were transfected at 70% confluency with 100 ng/mL 3p-hpRNA (Invivogen) using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2019Quote: ... the cells were selected using DMEM containing 10 µg/ml Blasticidin S (Invivogen, Toulouse, France) for 7 days ...
-
bioRxiv - Molecular Biology 2019Quote: ... but following transfection the cells were plated into conditioned media in 0.1µg/ml Puromycin (Invivogen). Correct integration of the construct in transfected cells was tested using PCR with a forward primer upstream of the 5’UTR of EP1 (agtccgataggtatctcttattagtatag ...
-
bioRxiv - Immunology 2019Quote: ... The positive clones (iR9-ESC/iPSC) were selected by Hygromycin B (150 μg/ml, Invivogen) were further cultured in ES medium supplemented with Dox (1 μg/ml) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... THP1-Lucia™ were treated alternately with zeocin and normocin (100 μg/mL; Invivogen, USA). HCEC-1CT cells were cultivated in Dulbecco’s Modified Eagle’s Medium (high glucose ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLV-mCherry stably infected cells were selected for 7 days with 1µg/mL puromycin (InVivoGen).
-
bioRxiv - Cell Biology 2021Quote: ... Cells were primed with a final concentration of 20 ng/ml LPS-EB ultrapure (InvivoGen) for 2 hrs in a cell incubator ...
-
bioRxiv - Immunology 2022Quote: ... the medium was refreshed with RPMI-1640 complete medium containing 10 μg/ml blasticidin (Invivogen). The medium was refreshed every 2-3 days for two weeks and identified the transfection efficiency by immunoblot ...
-
bioRxiv - Cell Biology 2022Quote: ... The day following transfection cells were treated with selection antibiotics: 10 μg/ml blasticidin (Invivogen) and 50 μg/ml hygromycin B (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were treated with 200 μg/ml G418 (InvivoGen, Pak Shek Kok, Hong Kong) for 4 d and then with 0.5 μg/ml puromycin (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Cells were stimulated with 2.5 µg/ml of R848 (Invivogen, catalog no. tlrl-r848-5) in complete medium (RPMI 1640 medium (catalog no ...
-
bioRxiv - Immunology 2022Quote: ... Two days after infection cells were selected for hygromycin resistance using 200μg/ml hygromycin (Invivogen). A pcDNA3-based plasmid containing the CMV-TetOn-24xPBS transcription reporter was transfected into the TetR expressing HeLa cells using Fugene according to the manufacturers’ instructions ...
-
bioRxiv - Immunology 2020Quote: ... BMDMs were mock treated (media only) or stimulated with 100 ng/mL of LPS (InvivoGen) for 4 h ...
-
bioRxiv - Physiology 2020Quote: ... the media was further supplemented with 200 μg/mL Hygromycin B (Invivogen, San Diego, CA). The CHO-K1 cells stably expressing HCN4 were grown in Ham’s F12 medium with L-glutamine (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... All culturing media were supplemented with plasmocin (2.5 μg/mL; Invivogen, San Diego, California, USA) to mitigate mycoplasma contamination ...
-
bioRxiv - Physiology 2021Quote: ... the media was further supplemented with 200 μg/mL Hygromycin B (Invivogen, San Diego, CA). HEK 293 cells were negative for mycoplasma infection ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines stably transducing expression constructs where supplemented with 100µg/mL of hygromycin (Invivogen), except for FGFR3-TACC3 which was supplemented with 800µg/mL of geneticin (Sigma-Aldrich).
-
bioRxiv - Immunology 2021Quote: ... THP1 cells were treated with phorbol 12-myristate 13-acetate (PMA, 10 ng/ml; Invivogen) overnight prior to infection ...
-
bioRxiv - Immunology 2021Quote: ... Two days after transduction transduced cells were selected with 500 μg/mL hygromycin B (Invivogen), and selected cell pools analyzed seven days after transduction.
-
bioRxiv - Cancer Biology 2020Quote: ... PBMCs were rested and stimulated with 100 ng/ml LPS (from E. coli K12, Invivogen) or 0.1 μM CpG 2006 (TIB MOLBIOL) ...
-
bioRxiv - Immunology 2020Quote: ... Mouse bone marrow-derived macrophages (BMDMs) treated with 0.5 μg/ml LPS (tlrl-smlps, Invivogen) for 3 h followed by 5 mM ATP (10519987001 ...
-
bioRxiv - Immunology 2021Quote: ... at 100 ng/mL or the TLR9 agonist class A CpG ODNs (CpG-A; Invivogen) at 5 μM or the STING agonist cGAMP (Invivogen ...
-
bioRxiv - Immunology 2020Quote: ... Slices were cultured overnight in complete media supplemented with 10 µg/mL OVA protein (Invivogen) or PBS ...
-
bioRxiv - Immunology 2021Quote: ... For gene expression analysis HL-60 cells were stimulated with 100 ng/ml LPS (InvivoGen) for 6 hours.