Labshake search
Citations for Invivogen :
2051 - 2100 of 2344 citations for Monobenzyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Cells were seeded at 2.5 × 105 cells/well in 24-well tissue-culture plates, treated with EtOH (1.69%, or 0.83%) 10 ng/mL LPS (Ultrapure LPS, E. coli 0111:B4, Invivogen), 500 μM or 1 mM palmitic acid (Sigma-Aldrich ...
-
BET protein inhibition regulates macrophage chromatin accessibility and microbiota-dependent colitisbioRxiv - Immunology 2021Quote: ... or vehicle control for 12 hours followed by the addition of 50 ng/mL LPS (InvivoGen, #tlrl-peklps) for 4 hours ...
-
bioRxiv - Immunology 2020Quote: ... Stable cell lines were selected by flow cytometry associated cell sorting (FACS) or puromycin selection (5µg/ml, Invivogen), respectively ...
-
bioRxiv - Cell Biology 2019Quote: ... Stable cell lines were obtained by FACS after two weeks of selection at 200µg/mL hygromycin (InVivoGen, France). Cell lines expressing β-catenin-GFP and α-catenin-GFP are gifts from W.J ...
-
bioRxiv - Microbiology 2021Quote: ... HeLa-Difluo hLC3 cells were maintained in growth medium supplemented with the selection antibiotic Zeocin 200μg/mL (Invivogen). One day before the experiment ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa Cyclin B1-GFP cells were grown in media containing 4 μg/ml blasticidin (Invivogen # ant-bl-05). HeLa Cyclin A2-GFP cells 25 were grown in media containing 9 μg/ml blasticidin (gifts of Francis Barr) ...
-
bioRxiv - Molecular Biology 2022Quote: ... E197A and D199A) were grown as described above except media was supplemented with 2.5 μg/ml blasticidin (InvivoGen) and 200 μg/ml Hygromycin B (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The infected cultures were selected by sorting of RFP+ cells 3 days after transduction and expanded in supplemented media with puromycin (2.5µg/ml; InvivoGen) and blasticidin (1µg/ml ...
-
bioRxiv - Microbiology 2022Quote: ... A549 cells were subjected to drug selections for ∼14 days at the following concentrations: puromycin −2ug/ml (Invivogen), hyrgromycin - 800ug/ml (Invitrogen) ...
-
bioRxiv - Genetics 2019Quote: ... the culture medium was replaced with DMEM supplemented with 10% FBS and 20 μg/ml blasticidin S (InvivoGen). The cultures were harvested at 2.9 days after transduction.
-
bioRxiv - Immunology 2020Quote: Resiquimod gill challenge was performed as previously described (33) using 5 μL of Resiquimod (0.5 mg/mL; Invivogen) applied to the gills for 5 min ...
-
bioRxiv - Immunology 2019Quote: ... Stained cells were cultured for 5 days in BCM supplemented or not with CpG (ODN2006, 2,5µg/ml, Invivogen), or cocultured with MS40 cells expressing CD40L and cytokine cocktail (recombinant human BAFF (10 ng/ml) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transfection media was aspirated and reduced serum media with 10 μg/mL of Poly(I:C) (InvivoGen, California, USA) was added to the cells for three days ...
-
bioRxiv - Microbiology 2020Quote: ... All HEK293 Flp-In T-REx cell lines were additionally supplemented with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen ...
-
bioRxiv - Bioengineering 2021Quote: ... These transformants were plated onto YPD and then replica plated onto selective media (YPD +10µg/ml phleomycin (InvivoGen)) after overnight growth ...
-
bioRxiv - Immunology 2021Quote: ... was added to the culture at 0.5μg/mL or vehicle control (endotoxin-free water) was added at a matched volume (InvivoGen). On day 2 of culture ...
-
bioRxiv - Immunology 2021Quote: ... For inflammasome activation on the day of the assay cells were treated with 10 ng/mL LPS (Invivogen), followed by 1 ug/mL poly dA:dT (Invivogen ...
-
bioRxiv - Immunology 2022Quote: 293T cells were transduced with pTRIP-hPGK-Blast-2A-STING-HA and selected with 15µg/ml Blasticidin (Invivogen) for one week ...
-
bioRxiv - Immunology 2022Quote: 293T cells were transduced with pTRIP-hPGK-Blast-2A-STING-TurboID and selected with 15µg/ml Blasticidin (Invivogen) for one week ...
-
bioRxiv - Immunology 2022Quote: ... Jurkat T cells were electroporated as described below and clones were selected with 800 µg/mL G418 (InvivoGen) antibiotic for 7 passages.
-
bioRxiv - Immunology 2022Quote: ... NK cells or T cells stimulated with 162 nM Phorbol-Myristate-Acetate and 2.68 μM ionomycin (PMA/I) or MoDCs stimulated with 30 μg/mL Poly (I:C) (Invivogen) were used as positive controls ...
-
bioRxiv - Immunology 2022Quote: ... isotype control antibodies at 0.3 μg/ml or an anti-HLA class I (MHC) positive control antibody (Invivogen) at 0.005 μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were selected using McCoy’s medium containing 2.5 – 5 µg/mL Blasticidin S (Invivogen # ant-bl-05) for 7 days ...
-
bioRxiv - Cancer Biology 2023Quote: ... and A375 cell lines were infected with the lentivirus followed by drug selection using Puromycin (1ug/mL, InVivoGen). An early passage (2 weeks post viral infection ...
-
bioRxiv - Cell Biology 2024Quote: ... per manufacturer’s instructions and stable cell lines were generated by polyclonal selection in 600 µg/ml hygromycin (InvivoGen).
-
bioRxiv - Microbiology 2022Quote: ... five different pseudotypes were generated using expression plasmids of respective spike variants: for prototype B.1/D614G as before (1) or sourced from Invivogen for VOCs Beta (Cat ...
-
bioRxiv - Immunology 2021Quote: ... BALB/c mice were vaccinated via the intramuscular route with 3 μg of each respective protein with 1:1 mixture of Addavax (Invivogen) in a total volume of 50 μL ...
-
bioRxiv - Microbiology 2022Quote: ... BALB/c mice were vaccinated via the intramuscular route with 3 μg of each respective protein with 1:1 mixture of Addavax (Invivogen) in a total volume of 50 μL ...
-
bioRxiv - Immunology 2023Quote: ... cells were pretreated with the caspase-1 inhibitor YVAD (Enzo) (1 μM) or with the NLRP3 inhibitor MCC-950 (Invivogen) (10 μM ...
-
bioRxiv - Immunology 2023Quote: The human monocytic THP-1 cell line (ATCC TIB-202) and the THP-1 DualTM reporter cell (InvivoGen, Thpd-nfis) were culture in RPMI supplemented with 10% heat-inactivated fetal calf serum ...
-
bioRxiv - Neuroscience 2023Quote: ... They were incubated overnight in blocking buffer solution with the primary Anti-mDectin-1-IgG antibody (1:50; cat# mabg-mdect, Invivogen) at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... 1 mg per dose of Poly I:C (InvivoGen), and 200 μg per dose of recombinant human IL-15 (Sino Biological) ...
-
bioRxiv - Microbiology 2020Quote: ... THP-1 Dual cells were obtained from Invivogen. Vero.E6 were provided by NIBSC ...
-
bioRxiv - Bioengineering 2023Quote: ... THP-1 cells (THP1-dual cells from InvivoGen) were maintained in RPMI 1640 (with 2 mM L-glutamine ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: THP-1 ISRE reporter cells (InvivoGen, thpd-nfis) were seeded in 384-well plates with 5,000 cells per well in a total of 30 μL of full medium containing RPMI 1640 (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... ssRNA40 was complexed with LyoVec (lyec-1, Invivogen) for 30min at RT before stimulation according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Puromycin was purchased from InvivoGen (#ant-pr-1). The Spike S1 Neutralizing Antibody (Clone#G10xA1 ...
-
bioRxiv - Immunology 2023Quote: THP-1-ASC-GFP cells (InvivoGen, CA, USA) were maintained according to manufacturer’s instructions using RPMI 1640 and 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... or caspase-1 inhibitor Ac-YVAD-cmk (InvivoGen) were added at indicated concentrations 30 min prior to treatment with DENV2 NS1 or nigericin.
-
bioRxiv - Cancer Biology 2023Quote: ... and Normocin™ (1X) (InvivoGen, ANT-NR-1). Tissue was then digested with 1 mL of enzyme-free dissociation agent HyClone™ (GE Healthcare Life Sciences ...
-
bioRxiv - Pathology 2020Quote: HEK-Blue™ Null1-v and HEK-Blue™-TLR4 (stably expressing TLR4, MD-2 and CD14 co-receptor genes) cell lines were obtained from Invivogen (SanDiego, CA, USA). HEK-Blue™ SR-AI and HEK-Blue™ CD36 were prepared by stably transfecting the parental cell line HEK-Blue™ Null1-v with plasmid pCMV/Hygro-SR-AI or pCMV/Hygro-CD36 (Sino Biological Inc. ...
-
bioRxiv - Cancer Biology 2021Quote: ... To analyze the interferon response HEK-Dual hTLR3 cells were treated with 5 μg/ml poly(I:C) HMW (InvivoGen) or the different extracted media for four hours ...
-
bioRxiv - Cell Biology 2020Quote: ... HeLa Flp-In TRex cells expressing GFP-Astrin variants cells were maintained in medium supplemented with 200μg/ml Hygromycin B (Invivogen) and 4μg/ml Blasticidin (Invivogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... while zeocin was added at 800μg/ml for counter selection of stable transfected cells (InvivoGen, cat n°ant-zn1). Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen ...
-
bioRxiv - Microbiology 2021Quote: ... H7-T7-IZ cells were maintained in a DMEM completed medium supplemented with 50 µg/ml of Zeocin (InvivoGen) and used for transfection of the T7 promoter-driven pTM expression vectors ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing the respective shRNA sequences (shINTS3: GCTGTGACCTCATTCGCTACA, shINTS6: ACCACTAATGATTCGATAATA, shINTS7: GCAGTAAAGAGACTTGCTATT) and 2.5 µg/ml puromycin (InvivoGen, #ant-pr) selection ...
-
bioRxiv - Microbiology 2020Quote: ... using the calcium phosphate precipitation technique and selected by treating the cells with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2022Quote: ... cells were washed for 5 minutes in PBS and incubated into PBS 1X with 1.67ug/mL of DAPI (Invivogen). Cells were washed for 5 minutes in PBS ...
-
bioRxiv - Immunology 2020Quote: ... and cells were stimulated with 100 μl milk EVs or EV-depleted controls in the presence or absence of 5 μg/ml Poly I:C (Invivogen). After 4 or 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were subjected to a selection process by maintaining in the medium in a presence of desired selection reagent (1μg/ml Blasticidin (#ant-bl, Invivogen), 400μg/ml Zeocin (#ant-zn ...