Labshake search
Citations for Invivogen :
1901 - 1950 of 2344 citations for Monobenzyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 1 v/v% normocin (Invivogen), 50 ng/ml EGF (Peprotech) ...
-
bioRxiv - Immunology 2023Quote: ... THP-1 (Invivogen, thpd-nfis), U937 (ATCC ...
-
bioRxiv - Physiology 2023Quote: ... and 1:500 Normocin (InvivoGen).
-
bioRxiv - Cancer Biology 2023Quote: ... and 1:500 Primocin (Invivogen). After digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... Puromycin (Invivogen, ant-pr-1). The following antibodies were used ...
-
bioRxiv - Genomics 2023Quote: ... blasticidin (ant-bl-1, Invivogen).
-
bioRxiv - Immunology 2023Quote: ... THP-1 Dual cells (Invivogen) were maintained in RPMI1640 supplemented with 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... puromycin (#ant-pr-1; InvivoGen) was added at a final concentration of 1 µg/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... + 1:5000 Primocin® (Invivogen), which specifically facilitates the outgrowth of basal cells ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg/μL primocin (InvivoGen), and 20 mM HEPES ...
-
bioRxiv - Immunology 2024Quote: ... Puromycin (Invivogen, ant-pr-1), Sytox Orange (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... were prepared for immunization via dilution in PBS and mixed 1:1 with Alhydrogel (Invivogen). For all single antigen immunizations ...
-
bioRxiv - Neuroscience 2023Quote: ... Rat neutralizing monoclonal anti-mDECTIN-1-IgG (clone R1-4E4) (Invivogen mabg-mdect, 1:30); Rat monoclonal anti-CD206 (clone MR5D3 ...
-
bioRxiv - Molecular Biology 2019Quote: ... livers of 10-week-old male or female mice were harvested 6 hours after tail-vein injection of LPS (2 mg/kg, Invivogen) or vehicle (PBS).
-
bioRxiv - Microbiology 2020Quote: ... A total of five adjuvants were tested for their efficacy within the vaccine formulations: Aluminum hydroxide gel (alum) (Alhydrogel adjuvant 2%, InvivoGen), Polyinosinic-polycytidylic acid (poly (I:C ...
-
bioRxiv - Immunology 2022Quote: ... cDNA encoding His-tagged Spike and RBD variants of SARS-CoV-2 were sub-cloned into pFUSE2ss-CLIg-hk (InvivoGen). The vectors were transfected as described for above the ACE2-albumin fusion protein and secreted His-tagged proteins were purified on HisTrap™ HP 1 mL columns (Cytiva) ...
-
bioRxiv - Immunology 2021Quote: ... by staining and acquiring control samples consisting of aliquots of fixed and frozen blood leukocytes from a healthy macaque after ex vivo stimulation of whole blood for 2 hours with three TLR ligands: LPS (LPS E. coli 0111: B4, Invivogen) at 1 μg/mL ...
-
bioRxiv - Immunology 2020Quote: ... The immunization mixture contained 13 μg of SARS-CoV-2-S-I53-50NPs (equal to 10 μg of SARS-CoV-2-S) adjuvanted with 50 μg of polyinosinic-polycytidylic acid (Poly-IC; Invivogen). Blood was collected at weeks-1,2 ...
-
bioRxiv - Immunology 2023Quote: ... were infected with either 30 μl of 500 TCID50 mouse-adapted PR8-HA-GP61-80 or 2×105 PFU of LCMV Armstrong by intranasal inoculation or immunized by intramuscular (quadriceps) injection with 2 μg LCMV recombinant glycoprotein (rGP) with addition of Addavax (InvivoGen) adjuvant at a 1:1 ratio ...
-
bioRxiv - Genetics 2023Quote: ... 5% CO 2 prior to stimulation under the same conditions with the following reagents and concentrations - Pam3Csk4 (Invivogen, Lot no.), LPS (Invivogen ...
-
bioRxiv - Cell Biology 2020Quote: ... After 48 hrs the cells were selected with 10 µg/ml blasticidin (InvivoGen, ant-bl) for 7 days ...
-
bioRxiv - Cell Biology 2019Quote: ... the cells were selected using DMEM containing 10 µg/ml Blasticidin S (Invivogen, Toulouse, France) for 7 days ...
-
bioRxiv - Molecular Biology 2019Quote: ... but following transfection the cells were plated into conditioned media in 0.1µg/ml Puromycin (Invivogen). Correct integration of the construct in transfected cells was tested using PCR with a forward primer upstream of the 5’UTR of EP1 (agtccgataggtatctcttattagtatag ...
-
bioRxiv - Immunology 2019Quote: ... The positive clones (iR9-ESC/iPSC) were selected by Hygromycin B (150 μg/ml, Invivogen) were further cultured in ES medium supplemented with Dox (1 μg/ml) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLV-mCherry stably infected cells were selected for 7 days with 1µg/mL puromycin (InVivoGen).
-
bioRxiv - Cell Biology 2021Quote: ... Selection was started 48 h after transduction using medium containing 1.5 mg/ml puromycin (InvivoGen). After 10 days ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were primed with a final concentration of 20 ng/ml LPS-EB ultrapure (InvivoGen) for 2 hrs in a cell incubator ...
-
bioRxiv - Immunology 2022Quote: ... the medium was refreshed with RPMI-1640 complete medium containing 10 μg/ml blasticidin (Invivogen). The medium was refreshed every 2-3 days for two weeks and identified the transfection efficiency by immunoblot ...
-
bioRxiv - Cell Biology 2022Quote: ... The day following transfection cells were treated with selection antibiotics: 10 μg/ml blasticidin (Invivogen) and 50 μg/ml hygromycin B (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were treated with 200 μg/ml G418 (InvivoGen, Pak Shek Kok, Hong Kong) for 4 d and then with 0.5 μg/ml puromycin (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Cells were stimulated with 2.5 µg/ml of R848 (Invivogen, catalog no. tlrl-r848-5) in complete medium (RPMI 1640 medium (catalog no ...
-
bioRxiv - Immunology 2022Quote: ... Two days after infection cells were selected for hygromycin resistance using 200μg/ml hygromycin (Invivogen). A pcDNA3-based plasmid containing the CMV-TetOn-24xPBS transcription reporter was transfected into the TetR expressing HeLa cells using Fugene according to the manufacturers’ instructions ...
-
bioRxiv - Physiology 2020Quote: ... the media was further supplemented with 200 μg/mL Hygromycin B (Invivogen, San Diego, CA). The CHO-K1 cells stably expressing HCN4 were grown in Ham’s F12 medium with L-glutamine (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... All culturing media were supplemented with plasmocin (2.5 μg/mL; Invivogen, San Diego, California, USA) to mitigate mycoplasma contamination ...
-
bioRxiv - Physiology 2021Quote: ... the media was further supplemented with 200 μg/mL Hygromycin B (Invivogen, San Diego, CA). HEK 293 cells were negative for mycoplasma infection ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines stably transducing expression constructs where supplemented with 100µg/mL of hygromycin (Invivogen), except for FGFR3-TACC3 which was supplemented with 800µg/mL of geneticin (Sigma-Aldrich).
-
bioRxiv - Immunology 2021Quote: ... THP1 cells were treated with phorbol 12-myristate 13-acetate (PMA, 10 ng/ml; Invivogen) overnight prior to infection ...
-
bioRxiv - Immunology 2021Quote: ... Two days after transduction transduced cells were selected with 500 μg/mL hygromycin B (Invivogen), and selected cell pools analyzed seven days after transduction.
-
bioRxiv - Immunology 2020Quote: ... Mouse bone marrow-derived macrophages (BMDMs) treated with 0.5 μg/ml LPS (tlrl-smlps, Invivogen) for 3 h followed by 5 mM ATP (10519987001 ...
-
bioRxiv - Immunology 2020Quote: ... Slices were cultured overnight in complete media supplemented with 10 µg/mL OVA protein (Invivogen) or PBS ...
-
bioRxiv - Immunology 2022Quote: Peritoneal macrophages from control or EROS-/- mice were primed overnight with LPS (100ng/mL, Invivogen) and treated for 2h with ATP (2.5mM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... This construct was then virally transduced and selected for with Blasticidin (10 μg/mL, Invivogen) and clonally selected by serial dilution.
-
bioRxiv - Immunology 2023Quote: ... the differentiation medium was replaced with fresh medium containing 10 µg/mL of Pam3CSK4 (Invivogen). After 2 h ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were selected in a medium containing 400 μg/mL hygromycin B Gold (InvivoGen) for 3 days.
-
bioRxiv - Molecular Biology 2023Quote: ... the ACE2-tranduced cells were selected for 10 days with zeocin at 15µg/mL (Invivogen).
-
bioRxiv - Immunology 2023Quote: ... were immunized intramuscularly with 1.5 μg purified nanoparticle immunogen in 100 μl (50 μl in each hind leg) of 50% (v/v) mixture of AddaVax adjuvant (Invivogen, San Diego, CA) (Figure 1 and S1) ...
-
bioRxiv - Immunology 2024Quote: ... mice were intradermally injected with 50 μg of neoantigen or control peptide and/or 100 μg high molecular weight VacciGrade polyinosinic-polycytidylic acid (poly(I:C) (Invivogen Cat. No. vac-pic)) ...
-
bioRxiv - Immunology 2022Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant (Invivogen, San Diego, CA) to reach a final concentration of 0.01 mg/mL antigen ...
-
bioRxiv - Immunology 2019Quote: Skin was washed in PBS with 1% Pen/Strep and 0.1% Primocin (Invivogen; ant-pm-1) for 5 minutes ...
-
bioRxiv - Immunology 2022Quote: ... The protein antigen was adjuvanted with AddaVax (1:1 v/v; vac-adx-10, InvivoGen, USA) for immunisation.