Labshake search
Citations for Invivogen :
1751 - 1800 of 1967 citations for Who Coplanar & Mono Ortho Pcb + Pcb 170 & Pcb 180 13C12 99% 20 Ng Ml In N Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... The next day the selection of the cells started with 300 μg/ml G418 (InvivoGen, #ant-gn-1). The selection was done till the colonies were big enough for picking after 7-8 days ...
-
bioRxiv - Cell Biology 2022Quote: ... and were selected for ten to fourteen days with a selection medium (contains 1 μg/ml Blasticidin [Invivogen, #ant-bl] ...
-
bioRxiv - Immunology 2022Quote: ... Jurkat T cells were electroporated as described below and clones were selected with 800 µg/mL G418 (InvivoGen) antibiotic for 7 passages.
-
bioRxiv - Immunology 2022Quote: ... NK cells or T cells stimulated with 162 nM Phorbol-Myristate-Acetate and 2.68 μM ionomycin (PMA/I) or MoDCs stimulated with 30 μg/mL Poly (I:C) (Invivogen) were used as positive controls ...
-
bioRxiv - Immunology 2022Quote: ... isotype control antibodies at 0.3 μg/ml or an anti-HLA class I (MHC) positive control antibody (Invivogen) at 0.005 μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Alternating passages of THP1 cells were treated with 200 μg/ml Hygromycin Gold (Invivogen cat. ant-hg-1) as recommended by Invitrogen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The cells were then transferred to the new YEA agar plate containing antibiotics [100 μg/mL G418 (InvivoGen) or 100 μg/mL nourseothricin (Gold Biotechnology)] and incubated at 32°C for at least 3 days to select the transformants ...
-
bioRxiv - Immunology 2023Quote: ... the cultures were incubated with or without a bacterial agonist cocktail (2ug/mL Pam3CSK4 (TLR1/2 agonist, InvivoGen), 1 ug/mL FSL-1 (TLR2/6 agonist ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were selected using McCoy’s medium containing 2.5 – 5 µg/mL Blasticidin S (Invivogen # ant-bl-05) for 7 days ...
-
bioRxiv - Bioengineering 2023Quote: ... The transfected cells were expanded to T-75 flasks and cultured with 2 µg/mL of puromycin (Invivogen), 10 µg/mL of blasticidin (Invivogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and A375 cell lines were infected with the lentivirus followed by drug selection using Puromycin (1ug/mL, InVivoGen). An early passage (2 weeks post viral infection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Post-transduction selection was conducted over five days with 0.5 µg/mL of puromycin (Invivogen, ant-pr-1) at an MOI of 0.15.
-
bioRxiv - Cell Biology 2023Quote: ... co-transfected cells were selected in culture medium supplemented with 3 μg/ml puromycin (Invivogen, ant-pr-1), until selection was complete after about 48 h ...
-
bioRxiv - Genomics 2023Quote: ... cells were cultured in the same medium supplemented with 200 μg/ml HygromycinGold B (Invivogen ant-hg-2). To generate cells with constitutive BFP expression ...
-
bioRxiv - Cancer Biology 2024Quote: ... OSCC cell lines were than infected with the lentiviruses followed by selection using 1 µg/ml puromycin (Invivogen)for 5 days ...
-
bioRxiv - Cell Biology 2024Quote: ... and maintained under selection pressure by additionally supplementing the above described medium with 1 µg/mL puromycin (Invivogen). HEK-293T were cultured in DMEM containing 4,5g/L D-glucose ...
-
bioRxiv - Cancer Biology 2024Quote: ... transfected clones were selected by drug selection with 1 μg/ml of puromycin (InvivoGen, San Diego, CA, USA). Mycoplasma testing was performed using an indirect immunofluorescence test ...
-
bioRxiv - Cell Biology 2024Quote: ... per manufacturer’s instructions and stable cell lines were generated by polyclonal selection in 600 µg/ml hygromycin (InvivoGen).
-
bioRxiv - Cancer Biology 2021Quote: ... To analyze the interferon response HEK-Dual hTLR3 cells were treated with 5 μg/ml poly(I:C) HMW (InvivoGen) or the different extracted media for four hours ...
-
bioRxiv - Cell Biology 2020Quote: ... HeLa Flp-In TRex cells expressing GFP-Astrin variants cells were maintained in medium supplemented with 200μg/ml Hygromycin B (Invivogen) and 4μg/ml Blasticidin (Invivogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 µg of pcDNA5 construct were co-transfected with 1.5 µg Flippase expression vector (pOG44) and cells were selected with 100 µg ml-1 Hygromycin (InvivoGen). All cell lines generated and plasmids used in this study are listed in Supplementary Table 1.
-
bioRxiv - Biochemistry 2020Quote: ... parasites were cultured with anhydrotetracycline medium at 250 nM (aTc+, MilliporeSigma) for 2 days before blasticidin /aTc+ medium was used (blasticidin at 2.5 µg/mL, InvivoGen).
-
bioRxiv - Immunology 2019Quote: ... The next day BMDMs were either left untreated or treated with 1 μM MCC950/CRID3 (S7809, Selleckchem) and then stimulated with 0.5 μg ml−1 ultrapure LPS from Salmonella minnesota (tlrl-smlps, Invivogen) for 3 h followed by 5 mM ATP (10519987001 ...
-
bioRxiv - Immunology 2019Quote: ... or PAL-CRID3 (0.001-100 µM) for 30 min and then stimulated with 5 μg mL−1 nigericin (Invivogen) for 30 min.
-
bioRxiv - Microbiology 2021Quote: ... H7-T7-IZ cells were maintained in a DMEM completed medium supplemented with 50 µg/ml of Zeocin (InvivoGen) and used for transfection of the T7 promoter-driven pTM expression vectors ...
-
bioRxiv - Immunology 2021Quote: ... were transduced 3 times with lentivirus containing supernatant and selected with 1 μg/ml Puromycin (Invivogen, San Diego, USA). Surviving cells were expanded and referred to as HEK293 luciferase reporter cells.
-
bioRxiv - Molecular Biology 2021Quote: ... containing the respective shRNA sequences (shINTS3: GCTGTGACCTCATTCGCTACA, shINTS6: ACCACTAATGATTCGATAATA, shINTS7: GCAGTAAAGAGACTTGCTATT) and 2.5 µg/ml puromycin (InvivoGen, #ant-pr) selection ...
-
bioRxiv - Microbiology 2021Quote: ... Two days post-transfection the media was replaced with DMEM containing 0.5% fetal bovine serum and NOD1 or NOD2 agonist [1 μg/ml C12-iE-DAP (Invivogen)+ 10 ng/ml human interferon gamma (AbD serotec ...
-
bioRxiv - Microbiology 2020Quote: ... using the calcium phosphate precipitation technique and selected by treating the cells with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2022Quote: ... cells were washed for 5 minutes in PBS and incubated into PBS 1X with 1.67ug/mL of DAPI (Invivogen). Cells were washed for 5 minutes in PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... were cultured in RPMI 1640 medium (GibcoBRL Technologies) with 10% heat-inactivated FBS and 100 μg/mL Zeocin (InvivoGen). NuFF-1 cells (GlobalStem ...
-
bioRxiv - Immunology 2022Quote: ... 2×104 DCs were co-cultured for 3 days with 5×104 FACS sorted naïve OT-II CD4+ T cells in the presence of 1 µg/ml OVA peptide (OVA323-339, Invivogen) and 0.25 ng/ml TGFβ (recombinant mouse TGF-b1 ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa EGFP-CHIP and HEK EGFP-CHIP cells were supplemented with blasticidin (10 µg/ml) (ant-bl-1, Invivogen) and hygromycin B (50 µg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... and MHC-I blocking antibody (W6/32; 50 ug/ml) in RPMI supplemented with human serum and primocin (Invivogen). Cells were harvested and stained with anti-CD3 FITC antibody (UCHT1 ...
-
bioRxiv - Immunology 2020Quote: ... and cells were stimulated with 100 μl milk EVs or EV-depleted controls in the presence or absence of 5 μg/ml Poly I:C (Invivogen). After 4 or 5 hours ...
-
bioRxiv - Immunology 2022Quote: ... d6-monocytes were stimulated with either 3pRNA as described above or 1 μg/ml P3CSK (InvivoGen, San Diego, USA) 5h prior to ATP challenge ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were subjected to a selection process by maintaining in the medium in a presence of desired selection reagent (1μg/ml Blasticidin (#ant-bl, Invivogen), 400μg/ml Zeocin (#ant-zn ...
-
bioRxiv - Biochemistry 2019Quote: ... coli NucC bound to 5’-pApA or cAAA in hanging drop format by mixing protein (8-10 mg/mL) in crystallization buffer plus 0.1 mM 5’-pApA (Invivogen) or cAAA 1:1 with well solution containing 17-24% PEG 3350 ...
-
bioRxiv - Cell Biology 2019Quote: ... the cells were subjected to a selection process by maintaining in the medium in a presence of desired selection reagent (1μg/ml Blasticidin (#ant-bl, Invivogen), 1μg/ml puromycin (#ant-pr ...
-
bioRxiv - Microbiology 2020Quote: ... Transduced HCT116cas9 cells were selected for 10 days and maintained in growing medium supplemented with 10μL/mL of Blasticidin (Invivogen).
-
bioRxiv - Biochemistry 2021Quote: Mice were divided into seven groups with 8 female mice in each group and alhydrogel adjuvant (1.25 mg/ml, InvivoGen) was used for the animal study ...
-
bioRxiv - Biochemistry 2021Quote: PMA-differentiated THP1 macrophages in 24-well plates were pretreated with fatty acids (2.5 μM and 10 μM) for 30 min prior to stimulation with 4 μg/mL cGAMP (InvivoGen) using Lipofectamine 2000 (Invitrogen) ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... The selection was started 48 hours after transfection using growth media supplemented with 500µg/ml Hygromycin Gold (ant-hg-1, Invivogen). Selection media was changed every 3-4 days until confluent colonies of stable transgenic cells had formed and cells were ready to be split.
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... experiments were grown in Dulbecco’s modified Eagle’s medium DMEM supplemented with 10% fetal bovine serum and 50ug/ml normocin (ant-nr-2, Invivogen). HEK293 cells and other cell lines used were grown at 37°C and 5% CO2.
-
bioRxiv - Cell Biology 2020Quote: ... Stable transfectants were obtained according to the manufacturer’s instructions by homologous recombination at the FRT were selected using 100 μg/ml Hygromycin B Gold (Invivogen). All live imaging was performed in Leibovitz’s L-15 medium (Gibco ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... they were subjected to a selection process by maintaining them in the presence of a suitable selection reagent (1μg/ml blasticidine [#ant-bl, Invivogen] ...
-
Mapping of the autophagosomal degradome identifies IL-7Rα as key cargo in proliferating CD4+ T-cellsbioRxiv - Immunology 2021Quote: ... total splenocytes isolated from OT-II mouse spleens were cultured with OVA 323-339 peptide (1 mg/ml, InvivoGen) and recombinant murine IL-2 (20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: ... the cells were pre-incubated for 30 min at 37°C with 5 μg/mL of anti-TLR2 monoclonal antibody (clone T2.5, InvivoGen) or with an isotype control (mIgG1 ...
-
bioRxiv - Immunology 2021Quote: ... Flow through sera was then applied to a gravity flow column containing 1 mL Peptide M-sepharose resin (InvivoGen) to purify IgA ...
-
bioRxiv - Immunology 2020Quote: ... detached with a cell scraper and resuspended at a density of 2.8 × 105 cells/mL in HEK-Blue Detection media (Invivogen). Neutralizing antibodies against TLR2 ...