Labshake search
Citations for Invivogen :
1651 - 1700 of 2085 citations for Who Coplanar & Mono Ortho Pcb + Pcb 170 & Pcb 180 13C12 99% 20 Ng Ml In N Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... Transfected cultures were selected using 40 μg/mL blasticidine (InvivoGen, San Diego, CA, USA) until stably transfected cell population was established.
-
bioRxiv - Bioengineering 2024Quote: ... FcγRI/CD64-positive cells were selected in media containing 50 µg/mL Zeocin (InvivoGen). Single-cell colonies were isolated using cloning discs and further continuously cultivated in the presence of 50 µg/mL Zeocin.
-
bioRxiv - Immunology 2024Quote: ... cell line was maintained in cRPMI supplemented with 100 μg mL−1 Zeocin (InvivoGen) and 100 U mL-1 Penicillin-Streptomycin (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... After 48 hrs the cells were selected with 10 µg/ml blasticidin (InvivoGen, ant-bl) for 7 days ...
-
bioRxiv - Microbiology 2019Quote: ... Transduced cells were then selected with both 3 μg/mL puromycin (InvivoGen #ant-pr-1) and 10 μg/mL blasticidin (InvivoGen #ant-bl-1 ...
-
bioRxiv - Immunology 2019Quote: ... RAW 264.7 cells were pretreated with MAb-mTLR2 (2 µg/ml) or isotype (Invivogen, US) for 2 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Successful integration was monitored by antibiotic selection with hygromycin B (100 µg ml−1, Invivogen) and blasticidin (5 µg ml−1 ...
-
bioRxiv - Cell Biology 2019Quote: ... the cells were selected using DMEM containing 10 µg/ml Blasticidin S (Invivogen, Toulouse, France) for 7 days ...
-
bioRxiv - Immunology 2019Quote: ... Splenic B cells were stimulated with either 1 μg/ml LPS (LPS-EB Ultrapure, InvivoGen), 1 μg/ml LPS + 20 ng/ml IL4 (Recombinant Murine IL-4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... but following transfection the cells were plated into conditioned media in 0.1µg/ml Puromycin (Invivogen). Correct integration of the construct in transfected cells was tested using PCR with a forward primer upstream of the 5’UTR of EP1 (agtccgataggtatctcttattagtatag ...
-
bioRxiv - Immunology 2019Quote: ... The OT1-iR9-iPSC positive clones were further selected by Puromycin (1 μg/ml, Invivogen) and the expression of OT1-TCR were measured by intra-cellular staining.
-
bioRxiv - Immunology 2019Quote: ... The positive clones (iR9-ESC/iPSC) were selected by Hygromycin B (150 μg/ml, Invivogen) were further cultured in ES medium supplemented with Dox (1 μg/ml) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable clones were established by culturing cells in media containing puromycin (1 μg/ml, InvivoGen) or blastocidin (5μg/ml ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 mM L-glutamine supplemented with 0.5 μg/ml puromycin (InvivoGen, San Diego, CA, USA). Both ...
-
bioRxiv - Cell Biology 2020Quote: ... Agonist were used as following concentrations: 5’ppp-dsRNA (2 μg/ml, tlrl-3prna, Invivogen) and 2’3’-cGAMP (10 μg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... THP1-Lucia™ were treated alternately with zeocin and normocin (100 μg/mL; Invivogen, USA). HCEC-1CT cells were cultivated in Dulbecco’s Modified Eagle’s Medium (high glucose ...
-
bioRxiv - Neuroscience 2021Quote: ... resiquimod (2 mg/kg of a 1 mg/ ml solution in PBS, Invivogen tlrl-r848), were administered subcutaneously on E12.5 between 9:00-11:00 am and their conditions were monitored to ensure that there was no sign of any severe sickness symptoms or abnormalities.
-
bioRxiv - Cancer Biology 2020Quote: ... pLV-mCherry stably infected cells were selected for 7 days with 1µg/mL puromycin (InVivoGen).
-
bioRxiv - Cell Biology 2021Quote: ... Selection was started 48 h after transduction using medium containing 1.5 mg/ml puromycin (InvivoGen). After 10 days ...
-
bioRxiv - Immunology 2022Quote: ... the medium was refreshed with RPMI-1640 complete medium containing 10 μg/ml blasticidin (Invivogen). The medium was refreshed every 2-3 days for two weeks and identified the transfection efficiency by immunoblot ...
-
bioRxiv - Bioengineering 2022Quote: ... and stimulated with 1 μg/mL R848 (TLR7/8 agonist; InvivoGen, Inc.; San Diego, CA) and 5 μg/mL of CD40 antibody ligand (clone ...
-
bioRxiv - Cell Biology 2022Quote: ... The day following transfection cells were treated with selection antibiotics: 10 μg/ml blasticidin (Invivogen) and 50 μg/ml hygromycin B (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were treated with 200 μg/ml G418 (InvivoGen, Pak Shek Kok, Hong Kong) for 4 d and then with 0.5 μg/ml puromycin (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Cells were stimulated with 2.5 µg/ml of R848 (Invivogen, catalog no. tlrl-r848-5) in complete medium (RPMI 1640 medium (catalog no ...
-
bioRxiv - Immunology 2022Quote: ... Two days after infection cells were selected for hygromycin resistance using 200μg/ml hygromycin (Invivogen). A pcDNA3-based plasmid containing the CMV-TetOn-24xPBS transcription reporter was transfected into the TetR expressing HeLa cells using Fugene according to the manufacturers’ instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... The cells were then treated with 2μg/ml of puromycin (InvivoGen cat # ant-pr-1). After 72 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells with successful nucleofection were then selected using puromycin (10ug/mL, InvivoGen ant-pr-1) for 48 hours ...
-
bioRxiv - Physiology 2020Quote: ... the media was further supplemented with 200 μg/mL Hygromycin B (Invivogen, San Diego, CA). The CHO-K1 cells stably expressing HCN4 were grown in Ham’s F12 medium with L-glutamine (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... All culturing media were supplemented with plasmocin (2.5 μg/mL; Invivogen, San Diego, California, USA) to mitigate mycoplasma contamination ...
-
bioRxiv - Physiology 2021Quote: ... the media was further supplemented with 200 μg/mL Hygromycin B (Invivogen, San Diego, CA). HEK 293 cells were negative for mycoplasma infection ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines stably transducing expression constructs where supplemented with 100µg/mL of hygromycin (Invivogen), except for FGFR3-TACC3 which was supplemented with 800µg/mL of geneticin (Sigma-Aldrich).
-
bioRxiv - Immunology 2019Quote: ... 1 μg/ml synthetic (B) form DNA analog poly(deoxyadenylic-deoxythymidylic) acid (poly(dA:dT)) (Invivogen) or 400 nM dsDNA containing GATC or Gm6ATC sequences ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in the medium with 10 μg/mL blasticidin (ant-bl-1, InvivoGen) for at least two weeks to achieve complete antibiotic selection before using for other experiments.
-
bioRxiv - Immunology 2021Quote: ... Two days after transduction transduced cells were selected with 500 μg/mL hygromycin B (Invivogen), and selected cell pools analyzed seven days after transduction.
-
bioRxiv - Bioengineering 2021Quote: ... ACE2-expressing cell lines were selected using 1 μg/mL puromycin from Invivogen (# ant-pr). Inducible Spike-expressing cell lines were generated from HEK293FTs by inoculating cells with two lentiviruses—one delivering the doxycycline-inducible Tet-On 3G transactivator and one delivering the Spike protein downstream of the TRE3G promoter ...
-
bioRxiv - Cancer Biology 2021Quote: ... Clones were further expanded and tested for puromycin (1.0 µg/ml; InvivoGen, #ant-pr-1) sensitivity ...
-
bioRxiv - Immunology 2020Quote: ... Mouse bone marrow-derived macrophages (BMDMs) treated with 0.5 μg/ml LPS (tlrl-smlps, Invivogen) for 3 h followed by 5 mM ATP (10519987001 ...
-
bioRxiv - Immunology 2020Quote: ... Cells were treated with 12.5 or 25 μg/mL 2’-3’cGAMP (Invivogen tlrl-nacga23) for 2 hr as indicated ...
-
bioRxiv - Microbiology 2020Quote: ... Selection drugs were added to the medium as appropriate: 10 µg mL-1 blasticidin (InvivoGen), 40 µg mL-1 puromycin (InvivoGen) ...
-
bioRxiv - Immunology 2020Quote: ... 1% (v/v) of penicillin/streptomycin and 100 µg/ml of Normocin/Zeocin/Blasticidin (InvivoGen). The test media for A549 and THP-1 cells excluded Zeocin and Blasticidin from their respective growth media.
-
bioRxiv - Immunology 2020Quote: ... Slices were cultured overnight in complete media supplemented with 10 µg/mL OVA protein (Invivogen) or PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... and positive cells were selected with 400 µg/ml hygromycin (InvivoGen, no. ant-hg-1) for 5 days ...
-
bioRxiv - Immunology 2022Quote: Peritoneal macrophages from control or EROS-/- mice were primed overnight with LPS (100ng/mL, Invivogen) and treated for 2h with ATP (2.5mM ...
-
bioRxiv - Cancer Biology 2022Quote: ... efficiently-infected cells were selected in cultures containing either puromycin (InvivoGen, 1 ∼ 1.5 µg/ml) or blasticidin (InvivoGen ...
-
bioRxiv - Microbiology 2023Quote: ... 10 µmol Y-27632 Rock inhibitor and 100 µg/ml normocin (InvivoGen, San Diego, USA) medium in a humidified 5% CO2 incubator at 37ºC ...
-
bioRxiv - Developmental Biology 2024Quote: ... we applied double reinforced selection of Puromycin (1.0 μg/ml, InvivoGen, no. ant-pr-1) and Doxycycline (Dox ...
-
bioRxiv - Immunology 2022Quote: ... the medium was refreshed with RPMI-1640 complete medium containing 2 μg/ml puromycin (Invivogen). The medium was refreshed every 2-3 days for two weeks and identified the transfection efficiency by immunoblot.
-
bioRxiv - Immunology 2023Quote: ... with 2% NuSerum medium (29) supplemented with Primocin (50 µg/ml, (InvivoGen, San Diego, CA), and retinoic acid (1 x 10−8 M ...
-
bioRxiv - Immunology 2024Quote: ... or by using ovalbumin peptide (OVA257-264, InvivoGen, San Diego, CA, USA; 1 μg/ml), which was loaded on DCs (used at a 3:1 T-to-DC ratio) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the ACE2-tranduced cells were selected for 10 days with zeocin at 15µg/mL (Invivogen).