Labshake search
Citations for Invivogen :
1601 - 1650 of 2005 citations for Testosterone 100 Ug Ml In Methylene Chloride 3 4 13C2 99%; 17 18O 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... Virus transduced cells were maintained for 2 weeks under blasticidin (10 μg/ml, Invivogen) selection ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Selection of stably expressing cells were performed using 150μg/mL Hygromycin B Gold (InvivoGen) as per kill curve (data not shown) ...
-
bioRxiv - Immunology 2019Quote: ... For M1 polarization macrophages were stimulated with 100ng/ml LPS (LPS EK-Ultrapure, Invivogen). To test how different TLR ligands activate CD38 ...
-
bioRxiv - Immunology 2020Quote: ... at 400 μg/ml or Blasticidin (Invivogen #ant-bl-05; for pUNO1-hDectin-1a) at 20 μg/ml for 2 weeks.
-
bioRxiv - Immunology 2021Quote: ... the positive clones (iRunx1-Lhx2-ESC) selected by hygromycin B (150 μg/ mL, Invivogen) were further cultured in ES medium supplemented with doxycycline (1 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... we used 2.5 nM WR99210 (Jacobus Pharmaceuticals) or 5 μg/ml blasticidin S (InVivoGen), respectively ...
-
bioRxiv - Immunology 2021Quote: ... along with pCMV-piggybac and resistant cells selected with 10 μg/mL blasticidin (Invivogen). The control TZMbl cell line not expressing S was generated by co-transfecting pCMV- piggybac with pT-pB-IRES-Blasti and selecting for blasticidin-resistant TZMbl cells.
-
bioRxiv - Immunology 2021Quote: ... transduced cells were selected and maintained in culture with 200 μg/mL hygromycin (Invivogen). STING expression was verified by western blotting.
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... Stable cells were selected with 0.5 µg/ml of puromycin (InvivoGen, #ant-pr-1) 1-2 days post transfection until no viable cells were detected in the negative control condition.
-
bioRxiv - Immunology 2021Quote: ... 1×106 PBMC were stimulated with 1ug/ml R848 (TLR7/8 agonist; Resiquimod (Invivogen)) diluted in complete RPMI (cRPMI ...
-
bioRxiv - Immunology 2021Quote: ... To analyze AIM2 inflammasome activation cells were stimulated with 10 ng/mL LPS (Invivogen), for 3h followed by 1 μg/mL poly dA:dT (Invivogen ...
-
bioRxiv - Genomics 2021Quote: ... followed by 48 hrs of puromycin selection (2 µg/ml, InvivoGen, San Diego CA), prior to experiments.
-
bioRxiv - Cancer Biology 2020Quote: ... Transduced cells were selected in 100μg/mL of Hygromycin (Invivogen, Cat # ant-hg-1) for seven days in the absence of TPA ...
-
bioRxiv - Cell Biology 2022Quote: ... 800Ω followed by selection with puromycin for one week at 50ug per ml (InvivoGen). Expression of transfected constructs was controlled using immunofluorescence microscopy assays (IFA ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were further cultured in the medium containing 1μg/mL Blasticidin (Invivogen, #antbl) and 200μg/mL Hygromycin B Gold (Invivogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... in the presence of 650 µg/ml hygromycin B Gold (Invivogen, ant-hg-1). By using limiting dilution assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retrovirally-infected cells were then selected with 10μg/mL blasticidin (Invivogen, ant-bl-1) for 5d prior to use for experimentation.
-
bioRxiv - Cell Biology 2022Quote: ... Transfected cells were selected with 600 µg/ml of G418 (Invivogen: ant-gn-5) in DMEM with 10% FCS and 100U/ml P/S followed by single cell cloning ...
-
bioRxiv - Immunology 2022Quote: ... irradiated splenocytes from naive C57Bl/6 mice were pulsed with 0.5mg/ml ovalbumin (InvivoGen). CD8+ T cells were isolated from the spleens of the vaccinated mice using CD8 magnetic microbeads (Miltenyi ...
-
bioRxiv - Microbiology 2023Quote: ... transduced cells were maintained for zeocin (50 μg/mL; Invivogen, Cat#ant-zn-1) selections for 14 days.
-
bioRxiv - Molecular Biology 2022Quote: ... Cells expressing C3G-mEGFP or mEGFP were selected with 10 μg/ml blasticidin (InvivoGen) for 3 weeks ...
-
bioRxiv - Microbiology 2023Quote: ... transfected cells were selected with 10 μg/ml of puromycin (Invivogen # ant-pr-1). After 48 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 15 min or with 50 μg/mL puromycin (Puro, Invivogen, ant-pr-1) for 30 min in the incubator at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were primed with B4 or B5 LPS (both 50 ng/mL Ultrapure, Invivogen) or Pam3CSK4 (500 ng/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... stably transfected cells were selected with 1.5 µg/ml of puromycin (InvivoGen, ant-pr). Cells were maintained in the presence of puromycin and ready to be used ...
-
bioRxiv - Cancer Biology 2023Quote: ... E2Crimson expression was maintained via 600 μg/mL Geneticin G418 (Invivogen, ant-gn-1), and 7.5% sodium bicarbonate (NaHCO3 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then incubated with 500 ng/ml lipopolysaccharide (LPS) from Escherichia coli (InvivoGen) for 2 h to induce lysosome tubulation and then washed in PBS and imaged in DMEM medium live.
-
bioRxiv - Cell Biology 2023Quote: ... Transduced cells were selected with 10 μg/mL puromycin (InvivoGen, cat#ant-pr-1) or 10 μg/mL blasticidin (InvivoGen ...
-
bioRxiv - Immunology 2023Quote: ... cells were selected via the addition of 3μg/mL puromycin (Invivogen, ant-pr-1). 96 hrs post-transduction ...
-
bioRxiv - Genomics 2023Quote: ... The cells that were successfully transduced were selected with 10 μg/mL Blasticidin (InvivoGen) for a week ...
-
bioRxiv - Biochemistry 2023Quote: ... the transduced cells were then selected in blasticidin (10 μg/mL, Invivogen, ant-bl) for 2 weeks ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transduced cells were selected using 1 μg/mL puromycin (InvivoGen, cat. ant-pr-1).
-
bioRxiv - Microbiology 2024Quote: ... 150 µL of 15 mg/mL of isolated peptidoglycan solution in LAL water (Invivogen) was mixed 1:1 with 5% sucrose and fed to flies from filter discs to test the expression of Dpt in the gut upon PNG ingestion ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single-cell colonies were subsequently isolated by selection with puromycin (5 µg/ml; InvivoGen) and the phenotype was analyzed by Western blot.
-
bioRxiv - Genomics 2024Quote: ... the td-Tomato-positive cells were selected using puromycin antibiotic selection (1μg/ml) (InvivoGen) and were kept under selection until the positive colonies reached 60-80% confluence ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were maintained in the presence of 5 µg/mL blasticidin (Invivogen, ant-bl) and 200 µg/mL zeocin (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... and the following selection antibiotics (in mg/ml): 0.005 Blasticidin (Invivogen, ant-bl-05), 0.50 Geneticin (G418 Sulfate ...
-
bioRxiv - Immunology 2023Quote: ... and positive cells were selected using 2 μg/mL puromycin (InvivoGen, ant-pr-1) for GFP and mCherry or 1 mg/mL G-418 solution (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... followed by continued maintenance in cell culture media supplemented with 10µg/mL Blasticidin (InvivoGen).
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... or ACM and treated with vehicle (PBS) or 3.5ng/mL blinatumomab (InVivoGen, # bimab-hcd19cd3) for 24h and 48h ...
-
bioRxiv - Genomics 2022Quote: ... the tissue was longitudinally cut and subjected to incubation in 3 mM EDTA in ice cold PBS with 1% (v/v) Primocin™ (InvivoGen, San Diego, CA; ant-pm-1) for 15 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... After 48 hrs the cells were selected with 10 µg/ml blasticidin (InvivoGen, ant-bl) for 7 days ...
-
bioRxiv - Immunology 2019Quote: ... RAW 264.7 cells were pretreated with MAb-mTLR2 (2 µg/ml) or isotype (Invivogen, US) for 2 h ...
-
bioRxiv - Cell Biology 2019Quote: ... the cells were selected using DMEM containing 10 µg/ml Blasticidin S (Invivogen, Toulouse, France) for 7 days ...
-
bioRxiv - Immunology 2019Quote: ... Splenic B cells were stimulated with either 1 μg/ml LPS (LPS-EB Ultrapure, InvivoGen), 1 μg/ml LPS + 20 ng/ml IL4 (Recombinant Murine IL-4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... but following transfection the cells were plated into conditioned media in 0.1µg/ml Puromycin (Invivogen). Correct integration of the construct in transfected cells was tested using PCR with a forward primer upstream of the 5’UTR of EP1 (agtccgataggtatctcttattagtatag ...
-
bioRxiv - Immunology 2019Quote: ... The OT1-iR9-iPSC positive clones were further selected by Puromycin (1 μg/ml, Invivogen) and the expression of OT1-TCR were measured by intra-cellular staining.
-
bioRxiv - Immunology 2019Quote: ... The positive clones (iR9-ESC/iPSC) were selected by Hygromycin B (150 μg/ml, Invivogen) were further cultured in ES medium supplemented with Dox (1 μg/ml) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable clones were established by culturing cells in media containing puromycin (1 μg/ml, InvivoGen) or blastocidin (5μg/ml ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 mM L-glutamine supplemented with 0.5 μg/ml puromycin (InvivoGen, San Diego, CA, USA). Both ...