Labshake search
Citations for Invivogen :
1551 - 1600 of 2126 citations for Testosterone 100 Ug Ml In Methylene Chloride 3 4 13C2 99%; 17 18O 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... and selecting cells with 10 µg/mL blasticidin (Invivogen ant-bl-1). The human Brunello CRISPR knockout pooled sgRNA library was a gift from David Root and John Doench (Addgene #73178) ...
-
bioRxiv - Immunology 2022Quote: ... blasticidin (Invivogen, cat. no. ant-bl-1, at 10 μg ml−1), and zeocin (Invivogen ...
-
bioRxiv - Microbiology 2022Quote: ... The parasites were selected with 5 μg/mL hygromycin B Gold (Invivogen). Overexpression was induced with 1 μg/ml tetracycline (Sigma-Aldrich).
-
bioRxiv - Systems Biology 2024Quote: ... Cells were then selected with the appropriate antibiotic: 2µg/ml Puromycin (Invivogen), 15µg/ml Blasticidin (Invivogen) ...
-
bioRxiv - Microbiology 2024Quote: ... iSLK cells72 were maintained in D10 supplemented with 2.5μg/ml puromycin (InvivoGen) and 250μg/ml G418 (Carl Roth) ...
-
bioRxiv - Immunology 2023Quote: ... the cells were diluted and stimulated with 1 µg/ml lipopolysaccharide (Invivogen), 50 ng/ml Phorbol-myristate-acetate and 1 µg/ml Ionomycin (both SigmaAldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the selection lasted for 2 weeks with blasticidin at 10µg/mL (Invivogen). For NoDiceΔPKR FHA:CTRL or DICER WT ...
-
bioRxiv - Molecular Biology 2023Quote: ... the selection lasted for 2 weeks with blasticidin at 15µg/mL (Invivogen). For NoDiceΔPKR ...
-
bioRxiv - Genetics 2023Quote: ... Cells were selected in 60 µg/mL zeocin (ant-zn-05, InvivoGen) followed by cell sorting by gating for mIFP-positive signal ...
-
bioRxiv - Plant Biology 2024Quote: ... Frozen cell suspensions were re-equilibrated with 1 ml Trizol reagent (Invivogen) and 200 μl chloroform (Honeywell) ...
-
bioRxiv - Immunology 2022Quote: ... cells were passaged in fresh complete IMDM containing 100ng/ml LPS (InvivoGen). On Day 8 ...
-
bioRxiv - Immunology 2022Quote: ... 1 mg/mL of whole OVA protein (Invivogen, San Diego, CA, USA) or γ-irradiated and CFSE stained B16F10 melanoma cells were added to the culture ...
-
bioRxiv - Microbiology 2023Quote: ... and selection was initiated with 0.5 mg/mL Geneticin-G418 (InvivoGen, USA). Plasmid-free transfected cells were used as a control ...
-
bioRxiv - Cell Biology 2023Quote: ... and 50 mg/mL primocin (ant-pm-1; InvivoGen, San Diego, CA). EM was used to expand the epithelial cell numbers as monolayers or organoids ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected with 1 µg/ml puromycin (Invivogen ant-pr-1).
-
bioRxiv - Cell Biology 2023Quote: ... and treated with HMW Poly(I:C) (10 μg/mL; Invivogen, tlrl-pic). To induce necroptosis HT-29 cells were pretreated for 1 h with BV6 (2,5 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were selected with 2 μg/mL puromycin (Invivogen: ant-pr-1).
-
bioRxiv - Bioengineering 2023Quote: ... and treated with ds-ppp-RNA positive control (1 µg/mL, (InvivoGen), ss-ppp-miRNA-21 (2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transfected cells were selected with 20 µg/ml blasticidin (Invivogen, ant-bl) for 3 days and 1 µg/ml puromycin for 7 days ...
-
bioRxiv - Cancer Biology 2023Quote: ... and selected with 4µg/mL blasticidin (InvivoGen; cat. no. ant-bl-1). The plasmid sequence was verified by whole-plasmid sequencing.
-
bioRxiv - Cancer Biology 2022Quote: ... Transduced cells were selected using puromycin (2μg/ml) (#ant-pr-1; InvivoGen).
-
bioRxiv - Immunology 2023Quote: ... Cells were transfected with 2 µg/ml poly(I:C) (Invivogen, tlrl-pic) or 2 µg/ml poly(dA:dT ...
-
bioRxiv - Immunology 2023Quote: ... Cells were stimulated with 250 ng/ml FLA-ST (Invivogen, tlrl-stfla) for 4 hr ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated to Puromycin (1 μg/ml; Invivogen, San Diego, CA) for 7-14 days to select for cells with the PCR cassette insert before being prepared for sorting.
-
bioRxiv - Immunology 2023Quote: ... Cells were activated by adding 1μg/mL lipopolysaccharide (LPS EB ultrapure Invivogen).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were treated with 1000 ng/mL puromycin (Invivogen ant-pr-1) for 5-7 days to select for a population where the donor was stably integrated in the intended locus prior to FACs enriching Citrine positive cells ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were then stimulated with 4µg/ml of cGAMP(pS)2 (Invivogen) for 6 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... lentiviral particles followed by selection with 10μg/ml blasticidin (Invivogen #ant-bl) for 72 hr ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were selected with 1 µg/mL puromycin (ant-pr-1, Invivogen) and pooled if the expression was homogeneous or cloned otherwise.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Puromycin selection was performed using 2 μg/mL puromycin (InvivoGen, Toulouse, France) to the culture medium 48 hours post transduction ...
-
bioRxiv - Immunology 2023Quote: ... The next day drug concentrations were increased to 10μg/ml puromycin (Invivogen) and 100μg/ml zeocin (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were enriched for 10 days using Zeocin (InvivoGen, 150 μg/ml).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and selected with 40 μg/ml hygromycin B (InvivoGen, San Diego, CA). Empty vector-transfected (EV ...
-
bioRxiv - Biophysics 2024Quote: ... 1 μg/ml LPS (Ultrapure LPS from E. coli, 0111:B4, Invivogen) and 4 µM total monomer of sonicated Aβ fibrils were loaded into the nanopipette ...
-
bioRxiv - Cancer Biology 2024Quote: ... Successfully transduced cells were selected with 1 µg/ml puromycin (InVivoGen, France). The shRNA expression for GLRX3 knockdown or expression of a negative control shRNA in EwS cells was achieved by adding 0.1 µg/ml Dox every 48 h to the medium ...
-
bioRxiv - Cell Biology 2024Quote: ... the virus-containing medium supplemented with 8 μg/ml of polybrene (InVivogen) was added into human iPSC culture ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were put into 1.5 µg/ml Puromycin (InvivoGen, ANT-PR-1) selection for 48 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were put into 10 µg/ml Blasticidin (InvivoGen, ANT-BL-1) selection for 4 days ...
-
bioRxiv - Immunology 2021Quote: ... 8 x 104 U937 cells per well of a 96 wells plate were exposed to 100 ng.mL-1 of phorbol 12-myristate 13-acetate (PMA; InvivoGen) for 48 h and primed with LPS at 1 μg.mL-1 for 3 h ...
-
bioRxiv - Immunology 2021Quote: 6-10 week old IFN-λ reporter mice were injected intravenously with sterile PBS or 100 µg polyI:C (InVivoGen). Splenocytes were harvested 6 hours after treatment ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of SpK combined with either BCG (BCGSpK) or 100 μg of Alhydrogel (Alum) (Invivogen, California, USA, AlumSpK), or a combination of BCG (5×105 CFU) ...
-
bioRxiv - Immunology 2021Quote: ... uninfected animals were treated intratracheally with 0.5 μg/kg of body weight of 5-OP-RU and 100 μg of CpG ODN 2006 (InvivoGen) mixed with 10 mg/kg of body weight of either rhesus macaque IgG4 isotype control antibody (DSPR4 ...
-
bioRxiv - Immunology 2023Quote: Other routes of administration: i) mice treated intraperitoneally (I.P) received 100 µg of a water soluble R848 formulation (Invivogen) dissolved in 200 µl of PBS ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Omicron Variant (B.1.1.529/BA.1) pLV-SpikeV11) and Omicron Variants (BA.4/BA.5) pLV-SpikeV13) were purchased from InvivoGen (San Diego, CA). The human T-Cell lymphoma Jurkat (E6-1 ...
-
bioRxiv - Immunology 2020Quote: ... Levels of SEAP were detected in the culture media after 3 hours incubation of supernatants with Quanti-Blue solution (InvivoGen, San Diego, CA, USA) at 650nm wavelength by ELISA reader.
-
bioRxiv - Immunology 2021Quote: Female IL-1βK133R/K133R and littermate WT control mice aged 6-8 weeks were intra-peritoneally injected with 100 μg LPS (Ultra-pure, Invivogen) and euthanized 2 hours later ...
-
bioRxiv - Microbiology 2019Quote: ... Each immunization consisted of 200 μl of antigen/adjuvant mix containing 50 μg of vaccine antigen and 100 μl of AddaVax adjuvant (Invivogen) via the subcutaneous (s.c. ...
-
bioRxiv - Microbiology 2020Quote: ... three BALB/c mice were each injected intraperitoneally (i.p.) with 100 μg of RBD-Fc fusion protein formulated with 500 μg of aluminum hydroxide (Alhydrogel, Invivogen, USA) and 25 μg of CpG (Sangon ...
-
bioRxiv - Microbiology 2020Quote: ... at 37 °C in 5 % CO2 and differentiated into macrophage-like phenotype cells by adding 100 nM of phorbol 12-myristate 13-acetate (PMA; InvivoGen) two days prior infection by ZIKV.