Labshake search
Citations for Invivogen :
1451 - 1500 of 2473 citations for Sodium Monofluoroacetate 90% Cp 13C2 99%; 2 2 D2 98% 1 Mg Ml In Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... We also administered either a 0.9% saline or a 5 mg/kg dose of LPS that is TLR4-specific (InvivoGen, tlrl-3pelps) by i.p ...
-
bioRxiv - Immunology 2020Quote: ... 7-to 8-week old WT mice were injected intraperitoneally with 10 mg/kg body wight of high molecular weight poly I:C (InvivoGen, tlrl-pic). The mice were then administered intraperitoneally 200 μl of DPBS containing no antibody (n = 15) ...
-
bioRxiv - Immunology 2019Quote: ... BMDMs from WT or Tlr2-/-mice were stimulated by rCsHscB (20 μg/ml) or Pam3CSK4 (200 ng/ml) (Invivogen, US) and supernatants were used for ELISA.
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Cell Biology 2021Quote: ... The stably transduced population of cells was selected using appropriate antibiotics (5 ug/ml puromycin or 50-100 μg/ml hygromycin Gold, both from Invivogen) for at least 5 days ...
-
bioRxiv - Microbiology 2022Quote: ... the medium was further supplemented with puromycin (7 μg/ml for selection of clones or 6 μg/ml for maintenance of cell lines; Invivogen) and/or hygromycin (100 μg/ml for selection of clones or 70 μg/ml for maintenance of clones ...
-
bioRxiv - Immunology 2022Quote: ... we supplemented the THP-1 dual cell line with the respective selection agents (100 μg/mL zeocin + 10 μg/mL blasticidin) and the corresponding selection cytostatics from Invivogen.
-
bioRxiv - Immunology 2022Quote: ... DC were cultured at 106 cells/ml in flat bottom plates for 24h or 48h in the presence of 50 ng/ml rhGM-CSF (Prospec) (unless differently specified) or 100 ng/ml ultrapure LPS (InvivoGen).
-
bioRxiv - Immunology 2022Quote: ... Immature moDC (0.5×106/ml) were stimulated with 100 ng/ml LPS (E. coli 0111 B4 strain, InvivoGen, San Diego) on day 5-6 in the presence or absence of F ...
-
bioRxiv - Immunology 2022Quote: ... Sorted cells were seeded at a final density of 1 x 106 cells/mL and were left unstimulated or stimulated with 100 ng/mL LPS (Escherichia coli O111:B4; Invivogen) or 1000 U/mL IFN-β (PBL Interferon Source ...
-
bioRxiv - Immunology 2020Quote: ... adherent cells were replated, and stimulated with either LPS (100ng/mL, Enzo) or whole glucan particles (100 μg/mL, Invivogen).
-
bioRxiv - Neuroscience 2019Quote: ... The iPSCs were maintained in Essential 8 complete medium with 100 μg/ml penicillin/streptomycin or 100 μg/ml Primocin (InvivoGen) on vitronectin (VTN-N)-coated cell culture plates (Corning ...
-
bioRxiv - Microbiology 2020Quote: ... were primed with LPS (10ng/ml for PBMCs and monocytes, 100ng/ml for monocyte-derived macrophages and monocyte-derived DCs, Invivogen) for 3 hr and then stimulated with heat-killed T ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell lines used for all mturboID-MS experiments were generated in HEK293 Flp-InTM T-RExTM cells as previously described14 and pool of stable transfectants selected with 200 μg/mL hygromycin (Multicell) and 5 μg/mL blasticidin (Invivogen). Expression of bait proteins were induced with 1 μg/mL tetracycline for 24 h ...
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 U/ml penicillin and 100 µg/ml streptomycin (MultiCell, Wisent) and in the presence of hygromycin B (200 µg/ml, MultiCell, Wisent) and blasticidin (10 µg/ml, InVivoGen) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.8×106cells seeded per micropattern in 3mL of CM with 20 ng/ml bFGF and 100 μg/ml Normocin (InvivoGen).
-
bioRxiv - Cancer Biology 2021Quote: ... or 5 μg/ml poly(I:C) HMW (InvivoGen). Two hours after induction cell viability was measured with alamarBlue ...
-
bioRxiv - Immunology 2021Quote: ... 10ng/ml Pam3CSK4 (InvivoGen, Cat. no.# tlrl-pms.), 100ng/ml Poly I:C (InvivoGen ...
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2022Quote: ... and 100 μg/ml of Zeocin™ (Invivogen). GHOST cells stably expressing CD4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were grown in 5µg/ml Hygromycin (Invivogen). PF cells were transfected using the same procedure ...
-
bioRxiv - Immunology 2021Quote: ... or 10mg/ml PI3 Kinase inhibitor (LY294002, Invivogen) as controls ...
-
bioRxiv - Cell Biology 2021Quote: ... and 100 μg/mL Primocin (Invivogen, Toulouse, France) before adding the cells to the culture plates.
-
bioRxiv - Bioengineering 2020Quote: ... mixed with 0.5 ml alum adjuvant (Alhydrogel, Invivogen) for each animal ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Molecular Biology 2021Quote: ... 50 μg/mL Primocin (Invivogen ant-pm-05), 3 μM SB202190 (Peprotech 1523072) ...
-
bioRxiv - Genetics 2022Quote: ... at 1μg/mL or blasticidin (Invivogen, ant-bl) at 5μg/mL).
-
bioRxiv - Cancer Biology 2022Quote: ... as well as 100 μg/ml Primocin (Invivogen). Cell lines were regularly checked for mycoplasma infections by Mycoplasma PCR-detection test (Thermo-Fisher).
-
bioRxiv - Synthetic Biology 2022Quote: ... 50 µg/mL hygromycin (InvivoGen, San Diego, CA) or 100 µg/mL nourseothricin (Gold Biotechnology ...
-
bioRxiv - Cancer Biology 2022Quote: ... or 6 µg/mL of blasticidine S (InvivoGen) for 10 days ...
-
bioRxiv - Immunology 2020Quote: ... Flagellin (TLR5; tlrl-stfla; Invivogen, 100 ng/ml), FSL1 (TLR2/6 ...
-
bioRxiv - Immunology 2020Quote: ... R837 (TLR7; tlrl-imqs; Invivogen, 10 μg/ml), and R848 (TLR7/8 ...
-
bioRxiv - Cell Biology 2022Quote: ... coli 055:B5 LPS (100 ng/ml, InvivoGen) 12 h before treatment.
-
bioRxiv - Microbiology 2022Quote: ... antibiotics and 2.5 µg/ml of plasmocin (InvivoGen). UMSCC-47 cells (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Hygromycin B Gold (50 μg/ml, InvivoGen) as selection antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Cell Biology 2019Quote: ... and treated with 200 μg/ml zeocin (InvivoGen) to select for stably transfected cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... and MPLA (100 ng/ml, #tlrl-mpls, InvivoGen), mouse IFNγ (33 ng/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Immunology 2019Quote: ... PAM3CSK4 (10 ng/ml, InvivoGen, San Diego, CA), (6 ...
-
bioRxiv - Neuroscience 2019Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Cell lysis and RNA extraction were performed 24h post-activation using Nucleospin RNA extraction kit (Macherey-Nagel) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 100 μg/ml Zeocin (InvivoGen, ant-zn-5p) and 5 μg/ml Blasticidin (InvivoGen ...
-
bioRxiv - Genomics 2021Quote: 20 ng/mL Lipopolysaccharide (LPS) (tlrl-3pelps, Invivogen),
-
bioRxiv - Microbiology 2020Quote: ... and 100 μg/ml of Zeocin™ (Invivogen).Caco-2 and Calu-3 cells were stimulated for 24 h with media containing TLR4 agonist Lipopolysaccharide (LPS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Transduced PSCs were Puromycin selected (2μg/mL) (Invivogen) and differentiated into definitive endoderm (DE ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Cancer Biology 2020Quote: ... 1.5 μg/ml puromycin (InvivoGen, San Diego, USA) was added to the medium to select for the Lhx2 expressing LSK cells ...