Labshake search
Citations for Invivogen :
1351 - 1400 of 2334 citations for Sodium Monofluoroacetate 90% Cp 13C2 99%; 2 2 D2 98% 1 Mg Ml In Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg/mL plasmocin (ant-mpp, Invivogen), and cultured in a humidified incubator with 5% CO2 at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... and puromycin at 0.1 μg/ml (InvivoGen).
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and Plasmocin prophylactic 5 µg/mL (Invivogen). COS7 and HeLaM cells for imaging experiments were seeded on glass-bottomed dishes (MatTek ...
-
bioRxiv - Biochemistry 2024Quote: ... and 100 μg/mL hygromycin B (Invivogen) in an orbital incubator at 37°C with 8% CO2.
-
bioRxiv - Immunology 2024Quote: ... or with LPS (100 ng/ml, InvivoGen) plus IFNγ (100 ng/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... 5-10 μg/ml blasticidin S (Invivogen) or FACS ...
-
bioRxiv - Microbiology 2024Quote: ... and 5 µg/mL prophylactic plasmocin (InvivoGen). Before passaging ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 2.5µg/ml of prophylactic plasmocin (InvivoGen) to prevent mycoplasma contamination during maintenance of the cells but was removed before any experimental assay (InvivoGen).
-
bioRxiv - Cancer Biology 2024Quote: ... 50µg/mL Primocin (Invivogen, ant-pm-05), 10µM Forskolin (Sigma/Merck ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 10 ug/mL blinatumomab (InVivoGen, # bimab-hcd19cd3) in PBS was added to CD19 probes for 1h ...
-
bioRxiv - Immunology 2024Quote: ... and activated with 1μg/mL CpG (Invivogen) for two days ...
-
bioRxiv - Cell Biology 2020Quote: ... selection for transduced cells was commenced by addition of 2.0 μg/ml puromycin or 300 μg/ml G418 (InvivoGen) or 8.0 μg/ml blasticidin (InvivoGen) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were seeded in a 96 well dish at 1.4×105 cells/mL (HEK-hTLR4) and 2.8×105 cells/mL (HEK-null2) in HEK detection media (Cat# hb-det3 Invivogen) as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... U2OS GFP-split cells transduced with pLenti6 were cultured in 1ug/ml puromycin and 10 ug/ml blasticidin (InvivoGen). The MucilAirTM primary human bronchial epithelial model was previously described (Robinot et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and/or hygromycin (100 μg/ml for selection of clones or 70 μg/ml for maintenance of clones; Invivogen). The human kidney epithelial cell line Lenti-X™ 293T (Takara ...
-
bioRxiv - Biochemistry 2022Quote: ... DOX-inducible cell lines generated in the parental TetOn-HeLa cell line were supplemented with 500 μg/mL G418 + 0.5 μg/mL puromycin (Invivogen).
-
bioRxiv - Microbiology 2020Quote: ... filtered through sterile miracloth and pipetted on a double selective PDA plate containing 0.1 M Tris pH 8 supplemented with 100 μg/ml hygromycin (Duchefa) and 100 μg/ml zeocin (InvivoGen). Double drug resistant colonies were selected after three days and monospored on a new plate supplemented with both drugs ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg μl-1 primocin (Invivogen ant-pm-1), 20 mmol/L HEPES at pH 7.4 and 25 μmol/L cytochalasin D.
-
bioRxiv - Immunology 2019Quote: ... We also administered either a 0.9% saline or a 5 mg/kg dose of LPS that is TLR4-specific (InvivoGen, tlrl-3pelps) by i.p ...
-
bioRxiv - Immunology 2020Quote: ... 7-to 8-week old WT mice were injected intraperitoneally with 10 mg/kg body wight of high molecular weight poly I:C (InvivoGen, tlrl-pic). The mice were then administered intraperitoneally 200 μl of DPBS containing no antibody (n = 15) ...
-
bioRxiv - Immunology 2019Quote: ... BMDMs from WT or Tlr2-/-mice were stimulated by rCsHscB (20 μg/ml) or Pam3CSK4 (200 ng/ml) (Invivogen, US) and supernatants were used for ELISA.
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Cell Biology 2021Quote: ... The stably transduced population of cells was selected using appropriate antibiotics (5 ug/ml puromycin or 50-100 μg/ml hygromycin Gold, both from Invivogen) for at least 5 days ...
-
bioRxiv - Microbiology 2022Quote: ... the medium was further supplemented with puromycin (7 μg/ml for selection of clones or 6 μg/ml for maintenance of cell lines; Invivogen) and/or hygromycin (100 μg/ml for selection of clones or 70 μg/ml for maintenance of clones ...
-
bioRxiv - Immunology 2022Quote: ... we supplemented the THP-1 dual cell line with the respective selection agents (100 μg/mL zeocin + 10 μg/mL blasticidin) and the corresponding selection cytostatics from Invivogen.
-
bioRxiv - Immunology 2022Quote: ... DC were cultured at 106 cells/ml in flat bottom plates for 24h or 48h in the presence of 50 ng/ml rhGM-CSF (Prospec) (unless differently specified) or 100 ng/ml ultrapure LPS (InvivoGen).
-
bioRxiv - Immunology 2022Quote: ... Immature moDC (0.5×106/ml) were stimulated with 100 ng/ml LPS (E. coli 0111 B4 strain, InvivoGen, San Diego) on day 5-6 in the presence or absence of F ...
-
bioRxiv - Immunology 2022Quote: ... Sorted cells were seeded at a final density of 1 x 106 cells/mL and were left unstimulated or stimulated with 100 ng/mL LPS (Escherichia coli O111:B4; Invivogen) or 1000 U/mL IFN-β (PBL Interferon Source ...
-
bioRxiv - Immunology 2020Quote: ... adherent cells were replated, and stimulated with either LPS (100ng/mL, Enzo) or whole glucan particles (100 μg/mL, Invivogen).
-
bioRxiv - Neuroscience 2019Quote: ... The iPSCs were maintained in Essential 8 complete medium with 100 μg/ml penicillin/streptomycin or 100 μg/ml Primocin (InvivoGen) on vitronectin (VTN-N)-coated cell culture plates (Corning ...
-
bioRxiv - Microbiology 2020Quote: ... were primed with LPS (10ng/ml for PBMCs and monocytes, 100ng/ml for monocyte-derived macrophages and monocyte-derived DCs, Invivogen) for 3 hr and then stimulated with heat-killed T ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell lines used for all mturboID-MS experiments were generated in HEK293 Flp-InTM T-RExTM cells as previously described14 and pool of stable transfectants selected with 200 μg/mL hygromycin (Multicell) and 5 μg/mL blasticidin (Invivogen). Expression of bait proteins were induced with 1 μg/mL tetracycline for 24 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 U/ml penicillin and 100 µg/ml streptomycin (MultiCell, Wisent) and in the presence of hygromycin B (200 µg/ml, MultiCell, Wisent) and blasticidin (10 µg/ml, InVivoGen) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.8×106cells seeded per micropattern in 3mL of CM with 20 ng/ml bFGF and 100 μg/ml Normocin (InvivoGen).
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Cancer Biology 2021Quote: ... or 5 μg/ml poly(I:C) HMW (InvivoGen). Two hours after induction cell viability was measured with alamarBlue ...
-
bioRxiv - Immunology 2021Quote: ... 10ng/ml Pam3CSK4 (InvivoGen, Cat. no.# tlrl-pms.), 100ng/ml Poly I:C (InvivoGen ...
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2022Quote: ... and 100 μg/ml of Zeocin™ (Invivogen). GHOST cells stably expressing CD4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were grown in 5µg/ml Hygromycin (Invivogen). PF cells were transfected using the same procedure ...
-
bioRxiv - Immunology 2021Quote: ... or 10mg/ml PI3 Kinase inhibitor (LY294002, Invivogen) as controls ...
-
bioRxiv - Cell Biology 2021Quote: ... and 100 μg/mL Primocin (Invivogen, Toulouse, France) before adding the cells to the culture plates.
-
bioRxiv - Bioengineering 2020Quote: ... mixed with 0.5 ml alum adjuvant (Alhydrogel, Invivogen) for each animal ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Molecular Biology 2021Quote: ... 50 μg/mL Primocin (Invivogen ant-pm-05), 3 μM SB202190 (Peprotech 1523072) ...
-
bioRxiv - Genetics 2022Quote: ... at 1μg/mL or blasticidin (Invivogen, ant-bl) at 5μg/mL).
-
bioRxiv - Cancer Biology 2022Quote: ... as well as 100 μg/ml Primocin (Invivogen). Cell lines were regularly checked for mycoplasma infections by Mycoplasma PCR-detection test (Thermo-Fisher).
-
bioRxiv - Synthetic Biology 2022Quote: ... 50 µg/mL hygromycin (InvivoGen, San Diego, CA) or 100 µg/mL nourseothricin (Gold Biotechnology ...