Labshake search
Citations for Invivogen :
51 - 100 of 158 citations for Rat Colony Assay Media since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: All source cell culture was maintained in media containing plasmocin (1:5000 dilution, Invivogen) to prevent mycoplasma contamination ...
-
bioRxiv - Molecular Biology 2020Quote: ... according to the manufacturer’s instructions and media were supplemented with Normocin during transfection (Invivogen).
-
bioRxiv - Immunology 2021Quote: ... Recovered larvae were washed with RPMI 1640 and resuspended in media containing Primocin (InvivoGen).
-
bioRxiv - Cell Biology 2022Quote: ... 1x pen/strep (complete explant culture media) and 1x Normocin (InvivoGen, # Ant-nr-1) for 12-14 days in T-75 culture flasks ...
-
bioRxiv - Biophysics 2023Quote: ... Cell culture media was supplemented with 3 µg/ml puromycin (InvivoGen, San Diego, USA). As a control ...
-
bioRxiv - Microbiology 2023Quote: ... followed by continued maintenance in cell culture media supplemented with 10µg/mL Blasticidin (InvivoGen).
-
bioRxiv - Immunology 2021Quote: ... For assays using neutralising antibodies to TLR2 (200μg/mL; Invivogen) or HCMV (500μg/ml ...
-
bioRxiv - Microbiology 2020Quote: Assays for flagellin detection were performed as instructed by Invivogen, using cells from passage 4-9 ...
-
bioRxiv - Cell Biology 2021Quote: Assay is based on reporter cell protocol outlined by Invivogen, but modified to incorporate two cell lines ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The assay was completed by adding Quanti-Blue™ (InvivoGen) to the supernatants ...
-
bioRxiv - Molecular Biology 2019Quote: ... but following transfection the cells were plated into conditioned media in 0.1µg/ml Puromycin (Invivogen). Correct integration of the construct in transfected cells was tested using PCR with a forward primer upstream of the 5’UTR of EP1 (agtccgataggtatctcttattagtatag ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable clones were established by culturing cells in media containing puromycin (1 μg/ml, InvivoGen) or blastocidin (5μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... BMDMs were mock treated (media only) or stimulated with 100 ng/mL of LPS (InvivoGen) for 4 h ...
-
bioRxiv - Physiology 2020Quote: ... the media was further supplemented with 200 μg/mL Hygromycin B (Invivogen, San Diego, CA). The CHO-K1 cells stably expressing HCN4 were grown in Ham’s F12 medium with L-glutamine (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... All culturing media were supplemented with plasmocin (2.5 μg/mL; Invivogen, San Diego, California, USA) to mitigate mycoplasma contamination ...
-
bioRxiv - Physiology 2021Quote: ... the media was further supplemented with 200 μg/mL Hygromycin B (Invivogen, San Diego, CA). HEK 293 cells were negative for mycoplasma infection ...
-
bioRxiv - Immunology 2020Quote: ... Slices were cultured overnight in complete media supplemented with 10 µg/mL OVA protein (Invivogen) or PBS ...
-
bioRxiv - Immunology 2021Quote: ... SEAP amounts were then measured in the cell culture supernatants using Quanti-Blue Detection Media (InvivoGen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 20μL of cell culture supernatant were added to 180 μL of Quanti-Blue detection media (Invivogen) and developed in the tissue culture incubator for 20 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... and resuspended at a density of 2.8 × 105 cells/mL in HEK-Blue Detection media (Invivogen). Neutralizing antibodies against TLR2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pTer-β-cat cell media was supplemented with 100 µg/ml Zeocin (InvivoGen, ant-zn-05) to select for the β-catenin RNAi cassette.
-
bioRxiv - Microbiology 2021Quote: ... The cells underwent selection with media containing 10 μg/mL of blasticidin (Invivogen; ant-bl-1) for two weeks ...
-
bioRxiv - Cancer Biology 2022Quote: ... All culture media were supplemented with Plasmocin (2.5 µg mL−1; InvivoGen, San Diego, CA, USA) to mitigate mycoplasma contamination ...
-
bioRxiv - Bioengineering 2022Quote: ... For FCM assay using hACE2-Fc (Invivogen, Catalogue code: fc-hace2), 5μL of the protein was incubated for 1 hour at 4°C with the cells using a similar assay condition described above ...
-
bioRxiv - Neuroscience 2020Quote: ... The reagents used to run the assay were acquired from InvivoGen. We used SoftMax Pro 5.4.1 (Molecular Devices ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged and resuspended in media with puromycin (0.6 μg/mL) (InvivoGen, San Diego, California, U.S.A). Cells were maintained with these conditions several days ...
-
bioRxiv - Biochemistry 2022Quote: ... and stably integrated cells were selected and maintained in media containing either zeocin (100 μg/mL; Invivogen), puromycin (500 ng/mL ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were trypsinized and re-plated in media containing 100 µg/mL hygromycin (InVivogen, ant-hg-1) to begin selection ...
-
bioRxiv - Immunology 2023Quote: ... and PRR expression was maintained by growing the cells in media containing Blasticidin (ant-bl-05, InvivoGen), Zeocin (ant-zn-05 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RAW-Blue ISG and Quantified-Blue assay kit were obtained from Invivogen, Ltd ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1% v/v BSA, Sigma; ITS liquid media supplement, Sigma; 0.9% v/v glucose, Sigma; 0.1mg/ml Primocin, InvivoGen) as previously described (Baptista et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were cultured in media prescribed by ATCC with the inclusion of a prophylactic dose of Plasmocin (Invivogen) to prevent mycoplasma contamination.
-
bioRxiv - Neuroscience 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). Neurons infected with GCaMP6f as stated above were infected with AAV9-hSyn-Cre (Addgene #105553-AAV9 ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). For calcium imaging experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa Cyclin B1-GFP cells were grown in media containing 4 μg/ml blasticidin (Invivogen # ant-bl-05). HeLa Cyclin A2-GFP cells 25 were grown in media containing 9 μg/ml blasticidin (gifts of Francis Barr) ...
-
bioRxiv - Molecular Biology 2022Quote: ... E197A and D199A) were grown as described above except media was supplemented with 2.5 μg/ml blasticidin (InvivoGen) and 200 μg/ml Hygromycin B (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The infected cultures were selected by sorting of RFP+ cells 3 days after transduction and expanded in supplemented media with puromycin (2.5µg/ml; InvivoGen) and blasticidin (1µg/ml ...
-
bioRxiv - Immunology 2021Quote: ... then 20 µL media from each well was added to 180 μL room temperature QUANTI-Blue Solution (InvivoGen) in a separate flat-bottom 96-well plate and incubated at 37°C for 3 hours ...
-
bioRxiv - Bioengineering 2021Quote: ... These transformants were plated onto YPD and then replica plated onto selective media (YPD +10µg/ml phleomycin (InvivoGen)) after overnight growth ...
-
bioRxiv - Microbiology 2022Quote: This assay was performed as described in (13) using RAW-blue cells (InvivoGen). Post treatment of RAW267.4 cells for 16 h with MTX (0.515 μg/ml ...
-
bioRxiv - Microbiology 2023Quote: This assay was performed as described in [45] using RAW-blue cells (InvivoGen). Post treatment of RAW267.4 cells for 15h with BOS (0.52 μg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1), B-27 (ThermoFisher #17504044 ...
-
bioRxiv - Immunology 2021Quote: ... Half-area tissue-culture-treated 96 well plates were filled with 10μl of each diluted sample followed by 90μl of the reporter cell lines suspended in HEK-Blue Detection Media (Invivogen). Assays were performed with cell densities of 1.4 x 105 cells/well (mTLR2 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were seeded in a 96 well dish at 1.4×105 cells/mL (HEK-hTLR4) and 2.8×105 cells/mL (HEK-null2) in HEK detection media (Cat# hb-det3 Invivogen) as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... and 10mM HEPES (UCSF Media Core Facility) in the presence of OVA257-264 peptide (0.1nM) (Invivogen, San Diego, California) and IL-2 (100U/ml ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... The selection was started 48 hours after transfection using growth media supplemented with 500µg/ml Hygromycin Gold (ant-hg-1, Invivogen). Selection media was changed every 3-4 days until confluent colonies of stable transgenic cells had formed and cells were ready to be split.
-
bioRxiv - Immunology 2020Quote: ... detached with a cell scraper and resuspended at a density of 2.8 × 105 cells/mL in HEK-Blue Detection media (Invivogen). Neutralizing antibodies against TLR2 ...
-
bioRxiv - Bioengineering 2023Quote: ... 20 µL of conditioned media was aliquoted and mixed with Quantiblue solution (rep-qbs2; Invivogen, San Diego, CA, USA) and incubated in a 96-well plate for an additional 4 hours before quantification via plate reader.
-
bioRxiv - Cell Biology 2023Quote: ... and then in plating media composed of 10% FBS in DMEM/F12 (SH30023.01, Cytiva) with 100 µg/mL Primocin (ant-pm, InvivoGen). Cells were then passed through a 70-µm cell strainer (258368 ...
-
bioRxiv - Microbiology 2022Quote: The Quanti-blue assay was conducted as per manufactures instructions (Quanti-Blue, Invivogen, UK). In brief ...