Labshake search
Citations for Invivogen :
551 - 600 of 682 citations for Sulfur Free Cobalt Metallo Organic Standard Co @ 5000 µg g in Hydrocarbon Oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... The transfected cells were expanded to T-75 flasks and cultured with 2 µg/mL of puromycin (Invivogen), 10 µg/mL of blasticidin (Invivogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Post-transduction selection was conducted over five days with 0.5 µg/mL of puromycin (Invivogen, ant-pr-1) at an MOI of 0.15.
-
bioRxiv - Molecular Biology 2024Quote: ... Transduced cells were selected by supplementing DMEM culture media with 4 µg/ml puromycin (Invivogen, ant-pr-1). In RKO-Cas9 cells genome editing was induced using 200 ng/ml or 350 ng/ml final concentration of doxycycline hyclate (Dox ...
-
bioRxiv - Microbiology 2024Quote: ... were immunized intramuscularly and boosted nine weeks later with 15 µg EtpA emulsified in PBS and AddaVax (InvivoGen). Draining iliac and inguinal lymph nodes were collected four days after boosting and single cell suspensions were prepared for plasmablast sorting ...
-
bioRxiv - Molecular Biology 2024Quote: ... Conditioned medium from the interferon response positive control: HCT116 WT cells transfected with PolyI:C (1 µg/mL, Invivogen) using Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then treated with 100 ng/mL LPS (Enzo Life Sciences, 100 µg/mL β-glucan (Invivogen) or 10-50 µM Hemin (Merck ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transfected with the indicated plasmids and selected using 200-1,000 µg/µL (gradually increasing) G418 (Invivogen) for two weeks ...
-
bioRxiv - Immunology 2021Quote: Fam13a KO and WT littermates were injected with 150 mg of toxin-free poly(I:C) (tlrl-pic, InvivoGen) in 100 µl PBS via intraperitoneal injection ...
-
bioRxiv - Immunology 2020Quote: ... partially oxidized (20%) with sodium (meta)periodate and coupled to endotoxin-free ovalbumin (OVA, EndoFit™ Ovalbumin, InvivoGen) using 2-step reductive amination with 50 mM sodium cyanoborohydride (NaCNBH3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the medium was exchanged for 10 mL DMSO-free medium containing 5 mg/mL Primocin (Invivogen, Toulouse, France), the tissue was minced in 10mL basal NSC in a cell culture petri dish using a sterile scalpel blade ...
-
bioRxiv - Genomics 2021Quote: ... we designed modified STARR-seq vectors in a CpG-free backbone with Lucia reporter gene (Invivogen, #pcpgf-promlc) driven either by the EF1α promoter (b ...
-
bioRxiv - Immunology 2021Quote: ... was added to the culture at 0.5μg/mL or vehicle control (endotoxin-free water) was added at a matched volume (InvivoGen). On day 2 of culture ...
-
bioRxiv - Biochemistry 2020Quote: ... parasites were cultured with anhydrotetracycline medium at 250 nM (aTc+, MilliporeSigma) for 2 days before blasticidin /aTc+ medium was used (blasticidin at 2.5 µg/mL, InvivoGen).
-
bioRxiv - Immunology 2021Quote: 6-10 week old IFN-λ reporter mice were injected intravenously with sterile PBS or 100 µg polyI:C (InVivoGen). Splenocytes were harvested 6 hours after treatment ...
-
bioRxiv - Microbiology 2021Quote: ... H7-T7-IZ cells were maintained in a DMEM completed medium supplemented with 50 µg/ml of Zeocin (InvivoGen) and used for transfection of the T7 promoter-driven pTM expression vectors ...
-
bioRxiv - Immunology 2021Quote: Splenocytes are extract from C57Bl/6j naïve mice previously stimulated in vivo for 14h by an intraperitoneal injection of 150 µg of Poly I:C (Invivogen). The MRC5 are plated at 5×104 cells/well in 48 wells plate the day before the experiment for the good adherence of the cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing the respective shRNA sequences (shINTS3: GCTGTGACCTCATTCGCTACA, shINTS6: ACCACTAATGATTCGATAATA, shINTS7: GCAGTAAAGAGACTTGCTATT) and 2.5 µg/ml puromycin (InvivoGen, #ant-pr) selection ...
-
bioRxiv - Microbiology 2020Quote: ... using the calcium phosphate precipitation technique and selected by treating the cells with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Immunology 2022Quote: ... 2×104 DCs were co-cultured for 3 days with 5×104 FACS sorted naïve OT-II CD4+ T cells in the presence of 1 µg/ml OVA peptide (OVA323-339, Invivogen) and 0.25 ng/ml TGFβ (recombinant mouse TGF-b1 ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa EGFP-CHIP and HEK EGFP-CHIP cells were supplemented with blasticidin (10 µg/ml) (ant-bl-1, Invivogen) and hygromycin B (50 µg/ml ...
-
bioRxiv - Immunology 2021Quote: ... expressed and purified as previously described (47)) in combination with 50 µg poly(I:C) adjuvant (HMW, InvivoGen tlrl-plc) per mouse ...
-
bioRxiv - Microbiology 2021Quote: BALB/c mice were immunized with 10 µg of SARS-CoV-2 RBD adjuvanted with 50% AddaVax™ (InvivoGen), via intramuscular route (i.m.) ...
-
bioRxiv - Genomics 2020Quote: ... These 4T1 cells were always kept in selection medium containing 10 µg/mL of blasticidin (ant-bl-05, Invivogen). When reaching 70% confluency ...
-
bioRxiv - Immunology 2022Quote: 2 × 106 pleura cells were plated and stimulated with 1 µg/mL poly(I:C) (Invivogen, San Diego, CA, USA) for 4 h at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... and then in plating media composed of 10% FBS in DMEM/F12 (SH30023.01, Cytiva) with 100 µg/mL Primocin (ant-pm, InvivoGen). Cells were then passed through a 70-µm cell strainer (258368 ...
-
bioRxiv - Immunology 2024Quote: ... mice were immunized with 1E4 plaque-forming units (PFU) of Vaccinia Western Reserve or 5 µg of poly I:C (Invivogen) with or without 5 µg of anti-CD40 (FGK4.5 ...
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
bioRxiv - Immunology 2022Quote: ... 1 µg purified S-EABR eVLPs were administered IM in the presence of 50% v/v AddaVaxTM adjuvant (Invivogen). Serum samples for ELISAs and neutralization assays were obtained on indicated days.
-
bioRxiv - Immunology 2023Quote: Other routes of administration: i) mice treated intraperitoneally (I.P) received 100 µg of a water soluble R848 formulation (Invivogen) dissolved in 200 µl of PBS ...
-
bioRxiv - Microbiology 2023Quote: ... cells were placed under drug selection in 10% FBS/RPMI containing 1 µg/ml puromycin (InvivoGen, Cat# ant-pr) or 6 ng/ml blasticidin (InvivoGen ...
-
bioRxiv - Microbiology 2023Quote: ... in 24-well plates were transfected with 0.1 µg of plasmid DNA per well using LyoVec transfection reagent (InvivoGen), according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were cultured for 2 weeks in the presence of 1 µg/mL puromycin (ant-pr-1, InvivoGen). The cells were single-cell-cloned using a limiting dilution method ...
-
bioRxiv - Immunology 2023Quote: ... Dried lipid film was resuspended in 500 μL of buffer containing 25 mM Tris-HCl (pH 8.0) - 150 mM NaCl (Lp buffer) and 2 µg of recombinant human mIL-1β (Invivogen) or 10 µg of LDH (Sigma) ...
-
Sex and species associated differences in Complement-mediated immunity in Humans and Rhesus macaquesbioRxiv - Immunology 2023Quote: ... The cells were maintained in RPMI-1640 containing 10% FBS and 1 µg/mL puromycin (InvivoGen, ant-pr-1). The THP-1 human monocytic cell line was purchased from ATCC and maintained in RPMI-1640 supplemented with 10% FBS and 55 µM beta-mercaptoethanol at 37°C with 5% CO2.
-
bioRxiv - Cancer Biology 2023Quote: ... and post-transduction selection was conducted over ten days with 10 µg/mL of Blasticidin (Invivogen, ant-bl-05) supplementation in TYK-nu media ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were incubated for 30 min at room temperature (RT) and 0.2 µg/ml of Fc-h-dectin-hFc (Invivogen) was added to the UV-irradiated conidia and incubated for 1 h at RT ...
-
bioRxiv - Microbiology 2024Quote: ... or an equal volume of phosphate-buffered saline (PBS) adjuvanted with 50 µg of poly(I:C) (High Molecular Weight) VacciGrade (InvivoGen) and boosted three weeks after in the same fashion ...
-
bioRxiv - Microbiology 2024Quote: ... of LP-PBL or its vehicle containing mannitol following the stimulation with 1 µg/ml Poly(I:C) (#5-pic-tlrl, InvivoGen). After 6 hours ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Transfected clones were selected for BSD resistance by treating cells with 10 µg/mL BSD (Invivogen, Ant-bl-05) for 7 days ...
-
bioRxiv - Genetics 2024Quote: ... Insertion of the TetOx96 and CuOx150 repair plasmids were selected using 6 µg/mL blasticidin (Invivogen ant-bl-1) and 400 µg/mL G418 (Invivogen ant-gn-5) ...
-
bioRxiv - Genetics 2024Quote: ... Selection for blasticidin-expressing infected cells was performed for 3 to 4 days using 3.0 µg/mL blasticidin (InvivoGen), which was added on the 3rd day post-infection.
-
bioRxiv - Molecular Biology 2021Quote: ... the zebrafish codon-optimized genes of the corresponding NIR FPs and mClover3 were cloned into an expression vector carrying the bidirectional promoter (p-EF1a:2xCMV:EF1a) consisting of two CpG free mCMV enhancers (Invivogen) each followed by CpG free hEF1alpha promoter (Invivogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were routinely checked to be free of mycoplasma contamination using Plasmo Test Mycoplasma Detection Kit (InvivoGen, rep-pt1).
-
bioRxiv - Immunology 2021Quote: ... For control purposes cells were stimulated with cytosolic 1 µg LPS using lipofectamine or nigericin (6.7 µM) (InvivoGen, tlrl-nig). 1% triton X100 was used as a lysis control in cell death assays (37) ...
-
bioRxiv - Neuroscience 2020Quote: Stably transfected HEK293 Flp-In T-Rex cells were grown and maintained in DMEM supplemented with 10% FBS and 100 µg/mL Hygromycin (InvivoGen) and 15 µg/mL Blasticidin (InvivoGen) ...
-
bioRxiv - Bioengineering 2021Quote: ... the culture medium was replaced with DMEM supplemented with 10% fetal bovine serum and 20 µg/ml blasticidin S (InvivoGen). Five days later ...
-
bioRxiv - Microbiology 2020Quote: ... were subcutaneously immunised with ZIKV antigen formulated in aluminium hydroxide gel (1% ALUM, Brenntag) combined with 5 µg monophosphoryl lipid A (MPLA)(InvivoGen) or PBS containing the adjuvant ...
-
bioRxiv - Immunology 2020Quote: ... The K562 cell line was cultured in the same media than NK cells supplemented with 5 µg/mL of Plasmocin (InvivoGen) and was routinely tested for mycoplasma infection with Venor GeM Classic detection kit (Minerva Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... 10 µg/ml Tri-Lys (negative control for NOD1/NULL1) or 10 µg/ml MDP-control (MDP-c; negative control for NOD2/NULL2) (InvivoGen) were used as treatment controls ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS media was replaced with fresh media and 24 hours later U2OS infected cells were selected with 2 µg/ml of puromycin (InvivoGen) for 72 hours.