Labshake search
Citations for Invivogen :
151 - 200 of 682 citations for Sulfur Free Cobalt Metallo Organic Standard Co @ 5000 µg g in Hydrocarbon Oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... 50 µg of poly I:C (Invivogen, USA), and 1 ml (20% v/v ...
-
bioRxiv - Immunology 2024Quote: ... LPS (1 µg/mL, tlrl-pelps; InvivoGen) for 6h ...
-
bioRxiv - Physiology 2024Quote: ... + 50 µg/mL Normocin (InvivoGen #ant-nr) during clinically-indicated lower endoscopy and transported on ice to the lab for immediate processing for spheroid generation ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 µg/ml blasticidin (InvivoGen, ant-bl), or 800 µg/ml neomycin (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µg/mL Primocin (InvivoGen, antpm-1), 1.25 mM N-Acetyl-L-cysteine (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... clarified by centrifugation and subsequently incubated with Peptide M(Invivogen)/Protein G-coupled sepharose beads (Invivogen, catalog# gel-pdm-5 ...
-
bioRxiv - Microbiology 2024Quote: ... and BS (2.5 .g/ml, InvivoGen) were added ...
-
bioRxiv - Pathology 2022Quote: ... A commercial standard of c-di-AMP (InvivoGen, Hong Kong, China) was used to determine the concentration by comparing the peak areas.
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 µg of pcDNA5 construct were co-transfected with 1.5 µg Flippase expression vector (pOG44) and cells were selected with 100 µg ml-1 Hygromycin (InvivoGen). All cell lines generated and plasmids used in this study are listed in Supplementary Table 1.
-
bioRxiv - Immunology 2021Quote: ... in the left and right mid-thighs with 50 µg MD39 and 500 µg alum (Alhydrogel adjuvant 2%; InvivoGen) per side ...
-
bioRxiv - Immunology 2023Quote: Cells were primed with 2 µg/mL (human primary Mo) or 10 µg/mL (BLaER1 Mo) of Pam3CSK4 (Invivogen) for 2 h before activation ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were selected with 2.5 µg/ml (PC3) and 5 µg/m (DU145) of blasticidin (InvivoGen ant-bl-1) for 7-9 days ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... both suspended in sterile RNase-free endotoxin-free water to a final concentration of 90 ng/μl (Invivogen). Each experiment was performed in triplicates and each biological replicate was composed of 100-150 injected zygotes per time point ...
-
bioRxiv - Cell Biology 2023Quote: ... was added to endotoxin-free water (Invivogen). Serial dilution was used to prepare a solution of 20 µg/mL of P ...
-
bioRxiv - Immunology 2023Quote: ... and 10µg Endotoxin-free Ovalbumin (“OVA”) (Invivogen). In some studies ...
-
bioRxiv - Immunology 2024Quote: ... 40mg of endotoxin free OVA antigen (Invivogen) adsorbed to 40μl of Alum hydrogel (Invivogen ...
-
bioRxiv - Cell Biology 2021Quote: All source cell culture was maintained in media containing plasmocin (1:5000 dilution, Invivogen) to prevent mycoplasma contamination ...
-
bioRxiv - Cell Biology 2024Quote: All source cell culture was maintained in media containing plasmocin (1:5000 dilution, Invivogen) to prevent mycoplasma contamination ...
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 U/ml penicillin and 100 µg/ml streptomycin (MultiCell, Wisent) and in the presence of hygromycin B (200 µg/ml, MultiCell, Wisent) and blasticidin (10 µg/ml, InVivoGen) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Microbiology 2024Quote: ... Cells transduced with lentiviruses encoding for the different gRNAs were passaged in selection medium containing 10 µg/ml blasticidin and 5 µg/ml puromycin (ant-pr-1, InvivoGen) to obtain polyclonal cell populations lacking either GSDMD or GSDME ...
-
bioRxiv - Immunology 2022Quote: ... Mice in the RBD + aluminum hydroxide condition received 10 µg of recombinant monomeric SARS-CoV-2 RBD protein formulated with 100 µg of Alhydrogel adjuvant 2% (Invivogen). Mice in the PBS vaccination group received phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2024Quote: ... PlatinumE cells were selected for 5 days using 1 µg/ml puromycin and 10 µg/ml blasticidin S (both Invivogen) and subsequently cultured ...
-
bioRxiv - Immunology 2024Quote: Immune responses were induced in 6-12-week-old male and female mice by subcutaneous immunization in the right FP with 5 µg (for HA experiments) or 10 µg (for hapten-carrier experiments) supplemented with 1/3 volume alhydrogel adjuvant (Invivogen). In S1pr2-Tomato mice ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK 293 T-REx FLAGXPO1 stable cell line maintained in the complete D-MEM culturing medium supplemented with 10 µg/ml blasticidin and 50 µg/ml hygromycin (InvivoGen). All transfections were carried out using either Lipofectamine2000 (plasmid ...
-
bioRxiv - Immunology 2022Quote: ... these co-expressed cell lines were selected under 300 μg/ml zeocin (Invivogen) for 10 days ...
-
bioRxiv - Immunology 2021Quote: ... 4 µg cGAMP (Invivogen, San Diego, Californien, USA), 4 µg c-di-UMP (Invivogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 15 µg/mL blasticidin (InvivoGen, ant-bl-1) at 37 °C in a humidified 5% CO atmosphere ...
-
bioRxiv - Immunology 2022Quote: ... 100 µg/mL Primocin (InvivoGen, ant-pm-1), 1.25 mM N-Acetyl-L-cysteine (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... R-848 (1 µg/ml, tlrl-r848; InvivoGen), CpG ODN 1826 (1 µg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Neuroscience 2021Quote: ... 67 or 1.6 µg of TLR2 antibody (Invivogen) or the same amount of IgG negative control antibody (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Systems Biology 2020Quote: ... was supplemented with 0.25 µg poly(I:C) (Invivogen) and 0.75 µl X-tremeGENE™ siRNA reagent ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 µg/mL normocin (InvivoGen# ant-nr-1). Thirty µL of 5 x10E5 THP-1 cells/ml were seeded per well of a 384-well plate and incubated at 37°C 5%CO2 for 24h ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 50 µg/mL hygromycin (InvivoGen, San Diego, CA) or 100 µg/mL nourseothricin (Gold Biotechnology ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5 µg/mL Puromycin (Invivogen #ant-pr-1), 200 μg/mL Hygromycin-B (Invivogen #ant-hg-1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... or 6 µg/mL of blasticidine S (InvivoGen) for 10 days ...
-
bioRxiv - Microbiology 2022Quote: ... antibiotics and 2.5 µg/ml of plasmocin (InvivoGen). UMSCC-47 cells (Millipore Sigma ...
-
bioRxiv - Immunology 2020Quote: ... mice were injected with 10 µg LPS (InvivoGen), 5 µg CGRP (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Cell Biology 2021Quote: ... 100 µg/mL primocin (Invivogen, ant-pm-2), 20 µM floxuridine ...
-
bioRxiv - Genomics 2020Quote: ... and selected with 20 µg/ml blasticidin (InvivoGen) for at least one week ...
-
bioRxiv - Immunology 2021Quote: ... poly (dA; dT)/ Lyovec (1 µg/mL, InvivoGen) was added along with LPS priming (1 µg/mL) ...
-
bioRxiv - Immunology 2023Quote: ... with 1 µg/mL Ionomycin (inh-ion; Invivogen) were also included as negative and positive controls respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... 100 µg/ml primocin (Invivogen ant-pm-1) and 100 nM dihydrotestosterone (DHT) ...
-
bioRxiv - Immunology 2023Quote: ... and 2 µg/ml CpG ODN 2006 (InvivoGen) weekly until the transformation ...
-
bioRxiv - Cell Biology 2024Quote: ... and 100 µg/ml of hygromycin B (Invivogen). Expression of NS4B-APEX protein was induced by incubating the cells with 1 ng/ml of doxycycline (Invitrogen ...