Labshake search
Citations for Biotium Inc. :
51 - 100 of 666 citations for PI 3065 CAS 955977 50 1 98% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... AM1-43 (Biotium, Fremont, CA) was diluted in sterile PBS and injected subcutaneously near the convergence of the wing and back ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5X EvaGreen (Biotium, Fremont, CA), 0.02 U/µl Phusion polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... 1X (Biotium, Fremont, CA, USA) as per manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5× EvaGreen (Biotium, Hayward, CA). The reaction profile consisted of 38 cycles of 94°C for 30 sec ...
-
bioRxiv - Immunology 2022Quote: ... 10 μl of each sample were loaded into a 1% agarose gel with gel red (Biotium, Fremont, CA, USA) together with 2 μL 6x loading dye (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2023Quote: ... the growth medium was removed and cells were incubated with 1 μM CellBrite™ NIR680 (Biotium, Fremont, CA, USA) for 20 min ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with TrueBlack® Lipofuscin Autofluorescence Quencher (1:20 with 70% ethanol; Biotium, Fremont, CA, United States) for 30 seconds to block endogenous fluorescence signal before washing in PBS (3 x 2 mins ...
-
bioRxiv - Developmental Biology 2024Quote: ... Lectins: Peanut Germ Agglutinin conjugated with a 488 fluorophore (1:100 concentration, #29060 Biotium, San Francisco, CA, United States) and Wheat Germ Agglutinin conjugated with a 405 fluorophore (1:50 concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... dihydrochloride (DAPI, 40043, Biotium, CA, America). For immunofluorescence staining of cut paraffin sections ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... CF®555 (Biotium, Fremont, CA). Nucleii were stained using 4′ ...
-
bioRxiv - Physiology 2022Quote: ... stained with GelRed (Biotium, Hayward, CA) and visualized on Gel Doc System (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Japan) for 2 h at room temperature and then stained with 1 μM Mito View Green solution (Biotium, Fremont, CA) and 4′,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were incubated at room temperature for 30 minutes in PBS containing LipidSpot reagent (1:1000; Biotium, Fremont, CA, USA), then washed 3x with PBS and mounted onto glass slides with Vectashield + DAPI.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Live stain cells were washed twice using 100 µl ASW and then incubated for 10 min in 50 µg/ml WGA-CF633 conjugate (Biotium, Cat No #29024-1) in ASW ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were incubated with 50 μL 1X DAPI (Biotium #40043) in PBS for 5 min at RT ...
-
bioRxiv - Microbiology 2022Quote: ... for 24 h and stained with a JC-1 Mitochondrial Membrane Potential Detection Kit using the manufacturers protocol (Biotium, Fremont, CA). The dye forms JC aggregates (orange ...
-
bioRxiv - Neuroscience 2023Quote: ... at room temperature for 60 min before incubation in PBS-T 0.3% with 3% NDS and CF405-conjugated streptavidin (1:1000; Biotium, CA, USA). After 90 min slices were washed in PBS (4x 10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies were used as follows: CF 488-conjugated goat anti-mouse IgG (H+L) antibody (20302-1; Biotium, CA, USA), CF 555-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Bioengineering 2021Quote: ... Eva Green Master Mix (Biotium, Fremont, CA) was used with custom-made forward and reverse primers (Table S1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... LipidSpot lipid droplet stain (Biotium, Fremont, CA) was added to the sections and incubated for 20 min ...
-
bioRxiv - Microbiology 2022Quote: ... and n were from Biotium (Fremont, CA); and coelenterazine e ...
-
bioRxiv - Cell Biology 2022Quote: ... Phalloidin conjugates were from Biotium (Fremont, CA). Plasmids encoding Pseudojanin (PJ ...
-
bioRxiv - Genomics 2020Quote: ... and qPCR were from Biotium (Fremont, CA). Oligonucleotides were obtained from IDT (Coralville ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20× in water (Biotium, Fremont, CA, USA), 0.5 µL of 10 µM 5× WGS_Pr_R1-5’ primer (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC ...
-
bioRxiv - Immunology 2021Quote: ... was conjugated with CF680 (Biotium, Fremont, CA) in 1:10 molar ratio ...
-
bioRxiv - Cell Biology 2021Quote: MitoView™ Green (Biotium, Hayward, CA, USA) was used to stain mitochondria in oocytes ...
-
bioRxiv - Molecular Biology 2023Quote: ... gels containing 0.5x GelRed (Biotium; Fremont, CA), and pseudoexon inclusion was quantified from molar ratios between PCR products using the Fragment Analyzer system (Advanced Analytical Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Gel red was from Biotium (Fremont, CA). Taq DNA polymerase was from Syd Labs (Hopkinton ...
-
bioRxiv - Microbiology 2022Quote: Propidium monoazide (PMA; Biotium, Inc., Fremont, CA) treatment concentrations of 30 and 50 μM and light exposure times of 60 ...
-
bioRxiv - Neuroscience 2024Quote: ... TrueBlack Lipofuscin Autofluorescence Quencher (Biotium, Fremont, CA) diluted in 70% ethanol was added to each slice for 30 seconds ...
-
bioRxiv - Plant Biology 2022Quote: ... and 20x EvaGreen Dye (Biotium, Hayward, CA) and run as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... and dihydrochloride (DAPI, 40043, Biotium, CA, America). The antibodies (Tables 2 and 3 ...
-
bioRxiv - Physiology 2023Quote: ... di-4-ANEPPS (7.5 µM, Biotium, CA) and positioned to center the anterior descending artery within the field of view ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or CF405M (# 29028, Biotium, Hayward, CA, USA) and/or DAPI ...
-
bioRxiv - Microbiology 2021Quote: ... The resultant triplicate PCR products for each sample were pooled and quantified using a 1% agarose gel stained with GelRed (Biotium, CA, USA). Quantified pooled triplicates were then combined in equimolar concentrations based on gel quantification to create an amplicon library ...
-
bioRxiv - Cell Biology 2022Quote: ... tendons were washed six times in PBS and placed in secondary antibody solution containing fluorescent CF488 anti-mouse secondary antibody (1:200; Biotium, Fremont, CA), Hoecsht 33342 (1:500 ...
-
bioRxiv - Pathology 2020Quote: ... PCSK9 promoter-driven firefly luciferase activity and control renilla luciferase activity were measured using the Firefly & Renilla Luciferase Single Tube Assay Kit (#30081-1; Biotium, Fremont, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL of each fecal inoculum was mixed with 2.5 µL of 20 mM propidium monoazide (PMA) dye (Biotium, Fremont, CA, USA). The samples were then incubated in the dark for 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were separated by electrophoresis through a 2% agarose gel in 1× TBE and stained with GelRed (Biotium, Hayward, CA, USA). To confirm the sequence of each band ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... GloMelt (λEx = 468, λEm = 507 nm) and carboxyrhodamine (ROX; λEx = 588, λEm = 608 nm) dyes (CAT #33022-1) were purchased from Biotium (Fremont, CA). Bovine serum albumin (BSA ...
-
bioRxiv - Biophysics 2024Quote: ... eosinophils were incubated with low-toxicity CellBrite Steady Red cytoplasmic membrane dye (1:200 dilution, Ex/Em 562/579 nm, Cat. 30107-T, Biotium, CA, USA) at 37℃ for 20 min ...
-
bioRxiv - Bioengineering 2022Quote: ... the cell aggregates were processed and imaged as described in the whole-mount immunofluorescence methods using Streptavidin (29072, Biotium, 1:500, CA, USA) and a DAPI (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... according to manufacturer’s protocol after a couple of days and CRISPR/Cas9 induced editing efficiency was analyzed by PCR and separation of amplicon on 2% agarose gel containing 1:10.000 GelRed nucleic acid gel stain (41003, Biotium Inc., Fremont, CA, USA). Amplicons were purified by MinElute Gel extraction kit (28606 ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies used were CF680- or CF770-conjugated anti-mouse and anti-rabbit IgG antibodies (1:5000, #20067 and #20077, Biotium, Hayward, CA, USA). Antibodies were diluted in Blocking One (Nacalai Tesque) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Approximately 5 µL of each PCR product was screened on 1.5% agarose gels stained with GelRed (Biotium, Fremont, CA, USA, Cat #41002-1). Each locus was then categorized based on the amplification profile ...
-
bioRxiv - Biophysics 2021Quote: ... CF640R-amine was purchased from Biotium (Fremont, CA). FuGENE HD transfection reagent was purchased from Promega (Madison ...
-
bioRxiv - Developmental Biology 2020Quote: ... EverBrite™ mounting media from Biotium (Fremont, CA) were used to mount coverslips and protect from photo bleaching.
-
bioRxiv - Neuroscience 2021Quote: ... Fluo-4AM (50μg; Biotium, Fremont, CA; Cat# 50018) was dissolved in 50μl Pluronic F-127 (Biotium ...
-
bioRxiv - Biophysics 2022Quote: ... CF640R-amine was purchased from Biotium (Fremont, CA). FuGENE HD transfection reagent was purchased from Promega (Madison ...
-
bioRxiv - Microbiology 2021Quote: ... was treated with PMA (Biotium, Inc., Hayward, CA) based on manufactureŕs recommendations and as previously described [39] to differentiate between cells with an intact membrane ...