Labshake search
Citations for VWR :
301 - 350 of 390 citations for Tripartite Motif Containing Protein 55 TRIM55 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... A maximum of 7.5% of the body weight was obtained in BD vacutainer tubes containing EDTA as anticoagulant (VWR, Ville Mont-Royal, Quebec). Adolescent mice were closely monitored for bleeding ...
-
bioRxiv - Microbiology 2022Quote: ... Supplemented M9 containing 0.85 mg/mL pluronic F127 without antibiotics was flowed via Tygon Microbore silicon tubing (VWR ND 100-80/0,508*1,524) that linked the device to a syringe pump (ALADDIN-220 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... each of which was part of a larger chamber containing 12 arenas each with a diameter of 2.54 cm (VWR cat. no. 89093-496). The bottom of each chamber contained a standard amount of either grapefruit medium or medium in which 15% of the water has been replaced with ethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5% (w/v) non-fat dry milk in TRIS-buffered saline (TBS) containing 0.1% Tween-20 (TBS-T; VWR, Radnor, PA, USA, # 28829.183) for one hour at room temperature and incubated with primary antibodies overnight at 4°C ...
-
bioRxiv - Genetics 2019Quote: We performed cell culture using the conditions described above in 12-well plates containing sterile 18-mm glass cover slips (VWR, Cat#48380-046). We fixed cells for 10 minutes in 4% paraformaldehyde (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: Antibiotic tolerance assays using co-cultures were performed using a membrane-separated 12-well tissue plate cultures containing 0.1 μm pore PET membranes (VWR, Cat. No. 10769–226), following previously protocols (Meirelles et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... we seeded 2×104 ESCs per well of a Geltrex-coated 12-well plate for subsequent RT-PCR and RT-qPCR analyses and 1-3×103 cells per well of a 12-well plate containing a Geltrex-coated 18-mm glass coverslip (VWR, cat# 631-1580) for immunostaining ...
-
bioRxiv - Immunology 2023Quote: ... The wells were emptied and blocked with 300 µL of PBS containing 1% BSA (Bovine Serum Albumin Fraction V, VWR Cat# 97061-416) for 1 h at 25°C ...
-
bioRxiv - Genetics 2023Quote: ... with a scalpel on a cold block (Figure 1b) and resuspended on ice in 1 ml of lysis buffer containing 0.32 M Sucrose (VWR Catalog No. 97061-432), 10 mM Tris-HCl pH 8 (Invitrogen REF 15568-025) ...
-
bioRxiv - Cell Biology 2020Quote: ... the medium was removed and filtered through a 0.45-µm low-protein binding membrane (VWR International, Radnor, PA). McArdle-RH7777 or IMR-90 were then transduced with the virus with 8 µg/ml polybrene (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2021Quote: ... all proteins were diluted in filtered (sterile syringe filters 0.45 μm cellulose acetate membrane, VWR International, Radnor, USA) Min buffer in the presence of either 0.5 mM ADP or ATP ...
-
bioRxiv - Genetics 2020Quote: Quadriceps from P10 pups were dissected and total proteins extracted using radioimmunoprecipitation assay (RIPA) buffer (VWR, Radnor, PA) supplemented with Halt Protease and Phosphatase Inhibitor Cocktail (ThermoFisher Scientific) ...
-
ZMYM2 is essential for methylation of germline genes and active transposons in embryonic developmentbioRxiv - Molecular Biology 2022Quote: ... The sheared DNA was then pre-cleared using magnetic beads (Sera-Mag Protein A/G SpeedBeads, VWR 17152104010150) for 1 hour to remove non-specific binding ...
-
bioRxiv - Cell Biology 2023Quote: ... and IRDye 680RD Goat-anti-Mouse antibody (VWR, Cat No:102673-408) at 1:20,000 dilutions ...
-
bioRxiv - Cancer Biology 2020Quote: Primary OSE cultures and the OSN2 cell line (Flesken-Nikitin et al. 2003) were maintained in culture in media containing DMEM (VWR; Cat#: 10-017-CM), Hams F12 (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... co-culture experiments were performed using membrane-separated 12-well tissue plate cultures containing 0.1 µm pore PET membranes (VWR® Cat. No. 10769-226). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... was mixed with deuterium oxide (450 µl) containing sodium formate (1 µmol/L) and then passed through a 10 KDa cutoff centrifugal filter (VWR, Radnor, PA, United States). 1H-NMR spectra were acquired using a 600 MHz spectrometer (Bruker AVANCE II ...
-
bioRxiv - Plant Biology 2021Quote: ... The samples were prepared according to the manufacturer’s instructions and proteins were separated in 10 % Next Gel SDS-PAGE (VWR). Carbonylated proteins were detected with Immobilon Western Chemiluminescent HRP Substrate (MilliporeSigma).
-
bioRxiv - Bioengineering 2022Quote: ... 50/15 mL Falcon tubes and 50/5/2 mL DNA/Protein loBind Eppendorf tubes were purchased from VWR. D02-E100-05-N and C02-E100-05-N tangential flow filtration filters were purchased from Repligen ...
-
bioRxiv - Immunology 2022Quote: ... The protein fraction was isolated by combining four times the volume of ice cold acetone (VWR Chemicals, PA, USA) to one volume of reconstituted PBMCsec ...
-
bioRxiv - Systems Biology 2020Quote: ... Protein and crosslink digestion was carried out by adding 50 μL freshly prepared 20 mg/mL Proteinase K (VWR, freeze-dried powder suspended in 10 mM Tris ...
-
bioRxiv - Molecular Biology 2022Quote: ... purification and validation of GST or His-tagged recombinant proteins from BL21(DE3) E.coli cells (VWR Cat#80030-326) were performed following vendor’s standard protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins production was induced with 1 mM [F1] IPTG 3h [F2] treatment (Isopropil-β-D-tiogalattopiranoside, VWR, Pennsylvania, USA). Then ...
-
bioRxiv - Molecular Biology 2023Quote: ... cultured in 150mm dish (Alkali scientific TDN0150) for protein experiment and in 6-well culture plate (VWR, 100062-892) for total RNA experiment and transfected at around 50-60% confluency ...
-
bioRxiv - Bioengineering 2023Quote: ... stably expressing enhanced green fluorescent protein (eGFP) were generated as described before[45] and cultured on 0.1% gelatin (VWR) pre-coated surfaces in MCDB-131 medium (Gibco ...
-
bioRxiv - Physiology 2024Quote: ... Western blot secondary antibodies included: donkey anti-rabbit HRP (VWR 95017, 1:1000) and sheep anti-mouse (GE Healthcare #NA931V ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Cell Biology 2020Quote: ... Residual lipids and proteins were cleared from the extracts by spin filtration in 3-kDa-molecular-weight spin cut-off filter (VWR) added 3 mg C18-material (Waters) ...
-
bioRxiv - Systems Biology 2020Quote: ... 4°C) and the soluble fraction was collected and protein precipitated using ice-cold acetone (25% final concentration, VWR, USA) for 1h at - 20°C followed by centrifugation (400x g ...
-
The evolution of red colour vision is linked to coordinated rhodopsin tuning in lycaenid butterfliesbioRxiv - Evolutionary Biology 2020Quote: ... Cells expressing opsin-membrane proteins were incubated in the dark during 1h at 4°C on a nutating mixer (VWR) to increase active rhodopsin complexes ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were stored at 4°C while the incubator cooled to 18°C and then protein expression was induced with 1 mM IPTG (VWR) and expressed at 18°C overnight ...
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... The proteins were detected by adding chemiluminescence detection reagent (ECL Amersham) to the membranes and exposing onto ECL Hyperfilm (VWR) for 30m.
-
bioRxiv - Biophysics 2020Quote: ... the untreated and treated bacteria (expressing H-NS-mEos3.2 fusion proteins) were filtered by 0.2 μm filters (VWR International LLC), resulting in filtrates constituting leaked cellular contents due to membrane damage ...
-
bioRxiv - Plant Biology 2023Quote: ... was added to deactivate the protein (45°C, 4 hours) and the DNA was purified through phase lock gel (VWR) and precipitated with 1/10 volume of 3 M Sodium Acetate (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... infrared (IR)-dye conjugate secondary antibodies IRDye 800CW Donkey Anti-Goat (VWR, #102673-336), IRDye 800CW Donkey Anti-Rabbit (VWR ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-rabbit secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-mouse secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-rabbit secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-mouse secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Developmental Biology 2020Quote: ... for blocking and with 0,2% Tween® 20 added for antibody dilutions (28829.296, VWR), washes were done with phosphate-buffered saline tween (PBST ...
-
bioRxiv - Cell Biology 2023Quote: ... The proteins were transferred to a PVDF membrane for 1.5 H at 400 mA and blocked using 5 % BSA (VWR, 103219-864) rocking at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... Blocking buffer and primary antibody incubation solution was 5% non-fat dairy milk powder (VWR) or 5% (w/v ...
-
bioRxiv - Physiology 2022Quote: ... frozen and crushed in liquid nitrogen for protein and RNA extraction or ii) embedded in Tissue-Tek OCT compound (VWR, Mississauga, Canada) and frozen in isopentane cooled with liquid nitrogen for cryostat sectioning54 or iii ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples containing 20-50 µg protein were separated by SDS polyacrylamide gel electrophoresis and transferred to a nitrocellulose or polyvinylidene fluoride membrane (10600023, VWR, Radnor, PA). After blocking the membrane for 1h in 3% BSA in Tris- buffered saline with Tween 20 (TBS-T) ...
-
bioRxiv - Bioengineering 2021Quote: Plant or mammalian produced SARS-CoV-2 RBD protein were diluted in sterile 1X PBS to 2 μg/mL and coated onto a 96-well plates (VWR #62402-959) (50 μL /well ...
-
bioRxiv - Systems Biology 2023Quote: ... Enzyme solutions for +M and -M conditions were prepared in separate 8-tube PCR strips (VWR #732-1521 or low-protein binding) by mixing 25 μL reaction buffer (+M/-M ...
-
bioRxiv - Cell Biology 2019Quote: ... the medium was refreshed and after additional 24 h virus was collected and filtered through a 0.45μm low protein binding membrane (VWR International, Radnor, PA, #28145-479). For dCas9-KRAB fusion protein expression and CRISPRi-mediated knockdown ...
-
bioRxiv - Neuroscience 2023Quote: ... the tissue sections were co-stained overnight at 4°C with a primary chicken antibody against the astrocyte marker Glial Fibrillary Acidic Protein (GFAP) (1:1000 in blocking solution; Cat No. 200-901-D60, VWR, Radnor, PA, USA) and a primary rat antibody against myelin basic protein (MBP ...
-
bioRxiv - Bioengineering 2021Quote: ... and secondary antibodies were diluted to 1:10,000 (100 ng/mL) in 2.5% BSA (0332, VWR) in Tris buffered saline tween ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were incubated in a primary antibody (CD63 for the endosomal system, clone MX-49.129.5, VWR, anti-LAMP1 for lysosomes ...