Labshake search
Citations for VWR :
301 - 350 of 2348 citations for 9 10 Dihydro 4H benzo 4 5 cyclohepta 1 2 b thiophen 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: Tissue sections were prepared from formalin-fixed paraffin embedded tissue blocks and cut to 4 micrometers serial sections and mounted on Superfrost Plus (VWR). The procedure for multiplex immunohistochemistry (mIHC ...
-
bioRxiv - Biophysics 2020Quote: ... The cell lysate was separated from insoluble material by centrifugation at 40,000 g for 60 minutes at 4 °C and subsequently incubated with a lysis buffer-equilibrated Ni-NTA column (HisPur Ni-NTA Superflow Agarose, Pierce, VWR) for 2 h at 4 °C on a rotator for affinity chromatography via the 6xHis-tag ...
-
bioRxiv - Plant Biology 2022Quote: ... 0.4 g of poly(FATRIFE-ter-PEGMA-ter-NBMA) terpolymer was dissolved in 25ml methyl-ethyl ketone (25642.325, VWR, UK) in a 500 ml rotary evaporator flask containing 20 g of FEP at 40 °C to coat FEP particles ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated at 4℃ to maintain their viability and passed through a 40 µm cell strainer (VWR, 76327-098) to dissociate single cells from clumps ...
-
bioRxiv - Biochemistry 2019Quote: ... microalgae were harvested via centrifugation at 13G (9000 rpm) for 20 mins 4°C using sterile 250 ml centrifuge tubes (VWR) and concentrated in a 50 ml sterile tubes (VWR ...
-
The evolution of red colour vision is linked to coordinated rhodopsin tuning in lycaenid butterfliesbioRxiv - Evolutionary Biology 2020Quote: ... Cells expressing opsin-membrane proteins were incubated in the dark during 1h at 4°C on a nutating mixer (VWR) to increase active rhodopsin complexes ...
-
bioRxiv - Cell Biology 2021Quote: ... After solidification of the gelatin block for 6h at 4°C it was embedded in a larger OCT block (Qpath, VWR) and subjected to cryosectioning (10 µm ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were resolved by SDS-PAGE using NuPAGE 4-12% Bis-Tris precast gels (Fisher Scientfic, WG1402BOX) and then transferred to 0.45μM nitrocellulose membranes (VWR, 10120-006). Membranes were then blocked with 5% nonfat dairy milk in Tris-buffered saline containing 0.1% Tween 20 (VWR ...
-
bioRxiv - Plant Biology 2023Quote: ... was added to deactivate the protein (45°C, 4 hours) and the DNA was purified through phase lock gel (VWR) and precipitated with 1/10 volume of 3 M Sodium Acetate (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant Jag1-Fc was immobilized by overnight incubation at 4°C in individual wells of non-tissue culture-treated 6 or 12 well plates (VWR) at a final concentration of 2 µg/mL in DPBS containing 10 µg/mL poly-D-lysine (ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2024Quote: ... were then exposed to cold treatments of -15°C for up to 48 hours (in increments of 4, 8, 12, or 48 hours) in a cooling circulator (VWR Scientific 1167P Heating/Cooling Recirculating Water Bath ...
-
bioRxiv - Biophysics 2023Quote: HeLa cells were fixed using 4% paraformaldehyde and permeabilized using Triton-X100 (VWR, Radnor, PA, USA, Cat. No. M143-1L) 12 hours after TTLL6-YFP transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were fixed by adding 100 µl 8% PFA for 20 min at RT (final concentration of PFA is 4%; PFA from VWR). All media was then gently removed and cells were washed 3 times for 5 minutes with 150 µl PBS ...
-
bioRxiv - Cell Biology 2024Quote: Plated cells were fixed for 10 minutes with 2% paraformaldehyde (PFA; VWR Chemicals, Cat# 28794.364) in phosphate buffer and washed for 3×5 minutes with PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... in a ratio of 1:10 in 1 mL of dichloromethanol (VWR BDH23373.400) and 50 μL of pyridine (Sigma-Aldrich #270970 ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Cell Biology 2023Quote: ... were dried to a 5 mm coverslip (Mentzel Glasser #1, VWR) and mounted on the sample holder using vacuum grease (Dow Corning high vacuum grease ...
-
bioRxiv - Microbiology 2022Quote: ... 1-BuOH ANALAR and 2-propanol HPLC grade from VWR international GmbH ...
-
bioRxiv - Microbiology 2021Quote: ... Each 20 μL PCR reaction was prepared with 9 μL 5Prime HotMaster Mix (VWR International), 1 μL forward primer (10 μM) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... PS pellets were dissolved in tetrahydrofuran solvent (THF purchased from VWR, CAS 109-99-9) (10 mg PS/mL THF ...
-
bioRxiv - Microbiology 2021Quote: ... ‘Fast’ shaking was established by orbital rotation of flasks at setting 4 on an orbital shaker (Model 3500, VWR, Radnor, PA), which corresponds to ∼200 rpm ...
-
bioRxiv - Cancer Biology 2021Quote: ... Matrigel containing organoid samples were removed from multi-well tissue culture dishes (using a 3.5 mL disposable transfer pipette and placed in 45 mL of cold PBS (4°C) in 50 mL capacity polypropylene centrifuge tubes (VWR Scientific). Matrigel was washed away by 3-4 rounds of suspension in cold PBS and centrifugation using a refrigerated centrifuge set to 1,000 pm ...
-
bioRxiv - Neuroscience 2021Quote: ... mice were deeply anaesthetized with isoflurane (4% flow rate of 0.5–0.7 l/min) and transcardially perfused with cold phosphate-buffered saline (PBS) followed by 4% PFA (VWR International Inc, 15710). Brains were extracted and placed in PFA for 24 h and then transferred to 30% sucrose/PBS solution at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... O/N at 4°C before processing for paraffin embedding and the other half was embedded in Optimun Cutting Temperature compound (VWR chemicals). At least 2 serial sections of 5 μm were stained with ...
-
bioRxiv - Physiology 2023Quote: ... the sulfhydryl groups were derivatized by transferring the final supernatant to 1.55 M NaOH and Na2B4O7·10H2O (125 mM with 4 mM EDTA, pH 9.5, VWR, Radnor, PA, USA) solutions ...
-
bioRxiv - Physiology 2023Quote: ... between the starting and ending levels of the removed capillary tubes were measured using a digital caliper (Traceable Carbon Fiber Caliper-4″, VWR International) to determine the volume consumed (after adjusting for evaporative losses) ...
-
bioRxiv - Molecular Biology 2024Quote: ... After overnight plating cells were treated with different doses of CDDP for 24 hours or with MMS for 8 hours and fixed with 4% PFA (VWR, AA47377) for 20 minutes and stored in PBS at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... tubes with mAb were incubated on a rotator at 4 °C overnight on a rotator (Model 13916- 822, VWR, United States). These mAb included anti-histone H3 (1:50 ...
-
bioRxiv - Microbiology 2024Quote: ... the transgenic gametocytes were pelleted at 1,400 xg for 3 minutes and fixed in 4% v/v paraformaldehyde (VWR, Cat# PI28908) and 0.0075% v/v glutaraldehyde (VWR ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, catalog # 97062-376, VWR) (5 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 0.01 mg/mL Hygromycin B (VWR, Cat# 45000-806). Cells were co-transfected with pXLone-dCas9-DNMT3A3L-P2A-EGFP and different pKH011-puro guide plasmids together with the piggyBAC transposase plasmid via electroporation with the Neon Transfection System (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... slides were incubated 10 min (1:4000, stock 1 mg/ml, VWR, Vienna, Austria) followed by rinsing in PBS (three times 5 min) ...
-
bioRxiv - Cell Biology 2019Quote: The four main arteries of PFA-fixed intact human brain were connected to a peristaltic pump (ISMATEC, REGLO Digital MS-4/8 ISM 834) through a chemical-resistant PTFE tubing (VWR, 228-0735) in a glass chamber ...
-
bioRxiv - Neuroscience 2019Quote: ... Our CAFÉ assay consisted of a 6-well plate with 4 small holes drilled for the insertion of pipette tips and 20 µl capillaries (VWR, Radnor, PA). Capillaries were filled via capillary action ...
-
bioRxiv - Neuroscience 2021Quote: ... Then the tissues were washed in PBS and stored at 4°C with 0.025% (w/v) sodium azide (VWR, Cat#786-299). For cryoprotection ...
-
bioRxiv - Biophysics 2020Quote: VLPs suspended in PBS buffer were mixed at 4°C with KIF5B-spycatcher in (buffer) for 7-8 hours on a nutating mixer (VWR, Radnor, PA) to ensure Spy Tag-Spy Catcher binding ...
-
bioRxiv - Neuroscience 2021Quote: ... Rats were then perfused intracardially with 100ml of 0.9% phosphate saline buffer (PBS) and 100ml of ice-cold 4% paraformaldehyde (PFA, BDH, Prolabo, VWR International, Lovaina, Belgium). Then ...
-
bioRxiv - Physiology 2021Quote: ... Tissue samples were embedded in paraffin and sections of 4 μm were coated with 43–45°C Kodak NTB emulsion (VWR, Herlev, Denmark) diluted 1:1 with 43–45°C water ...
-
bioRxiv - Neuroscience 2022Quote: ... Then incubated in 10% and 30% sucrose in PBS for 24 hr sequentially at 4 °C and embedded in the OCT compound (cat# 4583; VWR, Randor, PA). Coronal sections were cut at 20 or 50µm on a cryostat (CM3050S ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: For egg laying small Petri dishes (4 cm diameter) were filled with a 3% agarose (VWR life science; type number: 97062-250), 3% sucrose (Merck KGaA ...
-
bioRxiv - Neuroscience 2022Quote: ... Rats were then perfused intracardially with 100 ml of 0.9% phosphate saline buffer (PBS) and 100 ml of ice-cold 4% paraformaldehyde (PFA, BDH, Prolabo, VWR International, Louvain, Belgium). Then ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were transfected with retroviral Gag-pol (8 ug) and VSV-G (4 ug) packaging plasmids and pBabe vector (8 ug) using PEI Max transfection reagent (VWR, 75800-188). After 24 h ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were mounted non-sequentially (such that sections on the same slide were at least 4 apart) onto SuperFrost Plus slides (VWR, Lutterworth, UK) and air- dried ...
-
bioRxiv - Cell Biology 2022Quote: ... embedded in paraffin at least 12 hours and sliced (4 μm) using a Leica microtome on Superfrost Plus slides (VWR, 631-0108) prior to drying at 60°C for 1 hour ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The tumor and all the major organs (heart, lungs, spleen, kidney and liver) were fixed in 4% paraformaldehyde (PFA, Klinipath, VWR, PA, USA).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The animals were sacrificed 72h after the Hypoxisense 680 measurement with Dolethal (Pentobarbital Sodico) (200 mg/ml, Vetoquinol, Aartselaar, Belgium) and the tumors were fixed in 4% paraformaldehyde (PFA, Klinipath, VWR, PA, USA). Only histological procedures were performed on these tumors.
-
bioRxiv - Cell Biology 2023Quote: Human AT biopsies were washed twice in PBS to remove excess blood and divided in 50 to 100 mg for fixation in 4% PFA (paraformaldehyde, electron microscopy grade (VWR #100504-858)) for 2 hours at 4°C with gentle shaking ...
-
bioRxiv - Cancer Biology 2023Quote: ... we let the frozen slides reach –20 °C before transferring them directly to 1X PBS/4% paraformaldehyde (PFA) (VWR, cat. no. 10047105). We incubated the sections in PFA for 10 min at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... at 14 μm and collected sections into 4 sets of alternate series of SuperFrost Plus microscopy slides (VWR International, Randor, PA, USA). Slides were allowed to dry completely and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated for 5 minutes with fluorescent nuclear DAPI stain (VWR; 1:5000), and mounted with DAKO immunofluorescence mounting media (Life Technologies) ...