Labshake search
Citations for VWR :
1851 - 1895 of 1895 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Splenocytes were isolated from the spleen of 6-10-week-old OT-I male mice and pulsed with 2ug/ml of OVA peptide SIINFEKL (VWR, H-4866.0001BA) for 4 h in T cell culture media composed of RPMI1640 (GE Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... for 10 minutes at room temperature with gentle agitation on a plate rocker and mounted on microscope slides (VWR REF# 48311-703) with mounting medium containing DAPI ...
-
bioRxiv - Biochemistry 2019Quote: ... both supplemented with 10 μg/mL chloramphenicol (Cm) and 10 μM (mild induction) or 100 μM (strong induction) of isopropyl β-D-1-thiogalactopyranoside (IPTG) (43714 5X, VWR Chemicals) when necessary.
-
bioRxiv - Cell Biology 2019Quote: ... 15 μl of tissue suspension was pipetted onto a well of a 10-well PTFE diagnostic slide (631-1371, VWR International GmbH) and left to dry completely ...
-
bioRxiv - Cancer Biology 2021Quote: ... 48 hours post transfection lentivirus enriched medium was collected by centrifugation at 2000 rpm for 10 min and filtered through 0.45 μm sterile syringe filters (VWR International, 28145-481). LNCaP cells in 60mm dishes (0.4 million cells/dish ...
-
bioRxiv - Developmental Biology 2020Quote: ... for duck fibroblasts (i.e., CCL-141 cells) supplemented with 10% Fetal bovine serum (FBS, 97068-085, Lot# 283K18, VWR, Radnor, PA, USA) and 1X penicillin-streptomycin (15140122 ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of 1:10 diluted purified anti-SpB antibody1 and 2µL of Cy3 conjugated Goat Anti Rabbit IgG Polyclonal Antibody (VWR R611-104-122) were added to 40 µL of 0.4 O.D ...
-
bioRxiv - Cell Biology 2023Quote: Immunohistochemistry was performed on 10 μm fixed tissue sections prepared using a Leica cryostat on tissues frozen in OCT compound (Tissue-Tek, VWR Scientific, 4583). Whole-mount immunohistochemistry was performed as described.49 Mice were perfused with ice cold PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... and twice with dH20 / 0.4% Kodak Photoflo and air dried prior to mounting with VECTASIELD with DAPI mounting medium (VWR #H-1200-10) and a VWR Micro Cover Glass ...
-
bioRxiv - Molecular Biology 2023Quote: ... and two 10 mL samples of the skinnings were transferred to separate sterile 50 mL conical bottom tubes (VWR, Catalog #76204-404). All skinning samples were stored at -80 °C until DNA extraction (Fig ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well is washed with 1 mL of phosphate buffered saline (PBS) prior to fixation with 500 µL of 10% buffered formalin (VWR, 89379-094). After at least 24 hours of fixation ...
-
bioRxiv - Biophysics 2024Quote: ... with passage number ¡30 were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% Fetal Bovine Serum (VWR Seradigm Premium Grade), 50 units/mL Penicillin (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: Lyophilized liver samples were homogenized in 10 mM phosphate buffer at pH 6 (28 mg tissue per ml buffer) on a bead beater (VWR, Radnor, PA) for 1 min ...
-
bioRxiv - Bioengineering 2024Quote: After fabrication into their respective gelation baths using standard 100-1000 μL and 0.1-10 μL pipette tips (VWR International, Radnor, PA), K2 hydrogels were transferred to C2C12 growth media within a 12-well plate and stored in a 37° C incubator ...
-
bioRxiv - Immunology 2024Quote: ... Frozen tumour blocks were cryosectioned at 10 μm thickness using a Leica CM1900UV and mounted onto glass slides (VWR, Cat. 631-0108). Cryosections were stored at −80°C until staining ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures were then split into a negative control (no antibiotic) or antibiotic treatment (2 mL of culture per each treatment, using plastic Falcon tubes, VWR® Cat. No. 352059). After addition of the antibiotic from concentrated stocks ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μL cell suspension was loaded on YES agarose pad (2% agarose) and covered with 22 x 22 mm glass coverslip (VWR #631-0125, thickness: 1.5). Time-lapse imaging of mNG-cdc8 cells were performed at 30 °C with acquisition of 16 z-slices ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transfected cells from 2 wells (technical duplicates) were seeded into 250 mL cell culture flasks with vented caps (10062-860, VWR International, Brisbane, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... puncturing the central mineralized region at different locations with a disposable antistatic microspatula with a diameter of 2 mm (VWR international, Radnor, USA, PA). The samples were then sandwiched between two discs of 3 mm diameter ...
-
bioRxiv - Neuroscience 2022Quote: ... Brains were extracted and fixed for a minimum of 24 hours in PFA at 4 °C and transferred to a 2 % dimethyl sulfoxide solution (VWR International, Radnor, PA, USA) prepared in PB for at least 24 hours at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: Plasmids and corresponding oligonucleotides used in this study are summarized in Supplementary Tables 1 and 2. For DNA preparations, the appropriate enzymes (Fermentas, St. Leon-Rot, Germany) and kits (VWR International GmbH, Darmstadt, Germany) were used ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The active fractions from the NC-MT assay were separated in a 10% SDS gel and stained with coomassie blue (InstantBlue, VWR Chemicals, Darmstadt, Germany) or silver stain kit for mass spectrometry (Pierce/Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 24 h starved polyps were incubated in 1 mM linalool for 10 min in a 60 mm tissue culture dish (VWR International, Radnor, PA). Each animal was pinched using a pair of Dumont No ...
-
bioRxiv - Plant Biology 2021Quote: ... Membrane protein samples containing 1 μg total Chl were solubilized and separated by electrophoresis on a 10 % SDS-polyacrylamide gel using Next Gel solutions and buffers (VWR, Radnor, PA, USA). Proteins were transferred to Immobilon-P PVDF membranes (MilliporeSigma ...
-
bioRxiv - Neuroscience 2021Quote: ... Seed protofibrils were then prepared by sonicating the above incubated fibrils for 10 minutes using a 550T Ultrasonic Cleaner (VWR International, Radnor, PA). Note that the mature fibrils prepared by 23-day incubation were not processed ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were then incubated with 250 nM TG or 10 µM monensin in fresh medium for 0.5 h at 37°C before 40 µM D-biotin (VWR Life Science, Radnor, PA) was added ...
-
bioRxiv - Cell Biology 2020Quote: ... The cultivation media used for each cell line was recommended by the supplier with an addition of 10% Fetal Bovine Serum (FBS, VWR, Radnor, PA, USA). For immunostaining ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10% (HeLa) or 15% (Tig-1) fetal bovine serum (HyClone, GE Healthcare Life Sciences, Marlborough, MA; Avantor Seradigm, VWR, Radnor, PA), 100 units/mL penicillin and 100 µg/mL streptomycin (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: Monolayer cultures grown on Geltrex™ or laminin-coated #1.5 glass coverslips were fixed in 10% buffered formalin (Cat# CA71007-344, VWR, Radnor, PA, USA) for 10 minutes at room temperature and permeabilized with PBS-T (Ca2+/Mg2+-free PBS + 0.1% TWEEN® 20 (Cat# BP337-500 ...
-
bioRxiv - Bioengineering 2023Quote: ... in PBS at pH 10 at room temperature on an orbital shaker set at 150 rpm (no. 57018-754VWR; VWR International, Brisbane, CA). After 48 h ...
-
bioRxiv - Immunology 2024Quote: ... at a concentration of 1x105 neurons/ml so that 1x105 neurons were seeded onto poly-D-lysine (10 µg/mL) coated acid-etched coverslips (VWR,, cat#MSPP-P06G1520F) and cultured at 37°C plus 5% CO2 ...
-
bioRxiv - Cancer Biology 2020Quote: Primary OSE cultures and the OSN2 cell line (Flesken-Nikitin et al. 2003) were maintained in culture in media containing DMEM (VWR; Cat#: 10-017-CM), Hams F12 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... was mixed with deuterium oxide (450 µl) containing sodium formate (1 µmol/L) and then passed through a 10 KDa cutoff centrifugal filter (VWR, Radnor, PA, United States). 1H-NMR spectra were acquired using a 600 MHz spectrometer (Bruker AVANCE II ...
-
bioRxiv - Immunology 2022Quote: ... gentamycin (10 μg/ml for plasmid maintenance in E. coli; 100 μg/ml for plasmid maintenance in P. aeruginosa, VWR, Cat. No. 97062-974).
-
bioRxiv - Neuroscience 2023Quote: ... and stored at −20 °C in an anti-freeze solution (30 % glycerol [Merck Millipore, Germany], 30 % ethylene glycol [VWR International, USA] and 10 % TBS) until further processing ...
-
bioRxiv - Neuroscience 2023Quote: ... Elma Schmidbauer GmbH), mixed (10 min, 2035 rpm, HeidolphTM MultiReax) and centrifuged (1 min, 12300 RCF, Micro-Star 12, VWR®, Radnor, PA, USA). The total protein concentration in each sample was determined using the BCA assay in 10-20 μl sample aliquots ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Viable embryos at the 2-cell stage (0.75 hours post fertilization (hpf)) were sorted into 4 replicates of 10 embryos within 24-well plates (VWR international, LLC Radnor, PA, USA). Replicates were exposed to 1 mL of vehicle (0.1% DMSO ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris® RNA FISH Wash Buffer B was removed and samples were resuspended in Vectashield Antifade Mounting Medium with DAPI (VWR; Cat #: H-1200-10). Samples were then placed on a slide and sealed with a coverslip and nail polish.
-
bioRxiv - Microbiology 2019Quote: ... Diluted cells were plated onto fresh LB plates (15 ml medium per plate, the diameter of the plate is 10 cm and the height 15 mm, VWR, US, Catalog number 25384-342), and multiple dilutions were used ...
-
bioRxiv - Cell Biology 2021Quote: ... in the transfer buffer (25 mM Tris base [Acros Organics 42457-1000], 192 mM glycine [Sigma-Aldrich G8898], and 10% v/v methanol [VWR BDH1135] in water) at 18 V for 50-70 min at room temperature using the Mini Gel system (Invitrogen NW2000) ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing 10% fetal bovine serum (X&Y Cell Culture, Cat# FBS-500, Lot# 7B0302) and 100 U/mL penicillin/streptomycin (VWR Life Sciences, Cat# 82026-730). For IFNγ (R&D Systems ...
-
bioRxiv - Biochemistry 2020Quote: α-syn seeds were generated by sonication of α-syn aggregates at different aggregation time points for 10 minutes in a water bath sonicator (VWR® Symphony™ Ultrasonic Cleaner). 5% (m/m ...
-
bioRxiv - Biophysics 2020Quote: ... Confocal Microscopy—HeLa cells grown in 35 mm imaging dishes (made in-house from Corning 35 x 10 mm dishes with VWR 18 x 18 mm #1.5 cover slips) were imaged 48 hours post transfection to maintain consistency with the FACS measurements ...
-
bioRxiv - Biophysics 2020Quote: ... U2OS cells were grown in 35 mm imaging dishes (made in-house from Corning 35 x 10 mm dishes with VWR 18 x 18 mm #1.5 cover slips). All CyTERM constructs were transiently transfected for 18–24 hours using Lipofectamine 3000 (Invitrogen ...