Labshake search
Citations for VWR :
1051 - 1098 of 1098 citations for 7 9 Diazaspiro 4.5 decane 6 8 10 trione 7 ethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 15 μl of tissue suspension was pipetted onto a well of a 10-well PTFE diagnostic slide (631-1371, VWR International GmbH) and left to dry completely ...
-
bioRxiv - Cancer Biology 2021Quote: ... 48 hours post transfection lentivirus enriched medium was collected by centrifugation at 2000 rpm for 10 min and filtered through 0.45 μm sterile syringe filters (VWR International, 28145-481). LNCaP cells in 60mm dishes (0.4 million cells/dish ...
-
bioRxiv - Developmental Biology 2020Quote: ... for duck fibroblasts (i.e., CCL-141 cells) supplemented with 10% Fetal bovine serum (FBS, 97068-085, Lot# 283K18, VWR, Radnor, PA, USA) and 1X penicillin-streptomycin (15140122 ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of 1:10 diluted purified anti-SpB antibody1 and 2µL of Cy3 conjugated Goat Anti Rabbit IgG Polyclonal Antibody (VWR R611-104-122) were added to 40 µL of 0.4 O.D ...
-
bioRxiv - Biophysics 2022Quote: ... peptides were resuspended in 20 μL of resuspension buffer (5:95 ACN:MilliQ H2O, 0.1% TFA) and solubilized in a bath sonicator (VWR, 35 kHz, 10 min). A ZipTip was placed on a P10 pipettor set to 10 μL ...
-
bioRxiv - Microbiology 2022Quote: ... Spleen and brain were homogenized in 1 ml of sterile PBS followed by culture of 10-fold dilutions of each tissue on 2X GYE agar (2% glucose (VWR™, USA), 1% yeast extract (BD™ ...
-
bioRxiv - Microbiology 2022Quote: ... Mycobacterium smegmatis (ATCC 700084) was maintained in 7H9 media supplemented with 10% ADS enrichment: 50 g bovine serum albumin (VWR, Radnor, PA), 20 g dextrose (Fisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: After fabrication into their respective gelation baths using standard 100-1000 μL and 0.1-10 μL pipette tips (VWR International, Radnor, PA), K2 hydrogels were transferred to C2C12 growth media within a 12-well plate and stored in a 37° C incubator ...
-
bioRxiv - Immunology 2024Quote: ... Frozen tumour blocks were cryosectioned at 10 μm thickness using a Leica CM1900UV and mounted onto glass slides (VWR, Cat. 631-0108). Cryosections were stored at −80°C until staining ...
-
bioRxiv - Cell Biology 2023Quote: Immunohistochemistry was performed on 10 μm fixed tissue sections prepared using a Leica cryostat on tissues frozen in OCT compound (Tissue-Tek, VWR Scientific, 4583). Whole-mount immunohistochemistry was performed as described.49 Mice were perfused with ice cold PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... and twice with dH20 / 0.4% Kodak Photoflo and air dried prior to mounting with VECTASIELD with DAPI mounting medium (VWR #H-1200-10) and a VWR Micro Cover Glass ...
-
bioRxiv - Molecular Biology 2023Quote: ... and two 10 mL samples of the skinnings were transferred to separate sterile 50 mL conical bottom tubes (VWR, Catalog #76204-404). All skinning samples were stored at -80 °C until DNA extraction (Fig ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well is washed with 1 mL of phosphate buffered saline (PBS) prior to fixation with 500 µL of 10% buffered formalin (VWR, 89379-094). After at least 24 hours of fixation ...
-
bioRxiv - Biophysics 2024Quote: ... with passage number ¡30 were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% Fetal Bovine Serum (VWR Seradigm Premium Grade), 50 units/mL Penicillin (Life Technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The active fractions from the NC-MT assay were separated in a 10% SDS gel and stained with coomassie blue (InstantBlue, VWR Chemicals, Darmstadt, Germany) or silver stain kit for mass spectrometry (Pierce/Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 24 h starved polyps were incubated in 1 mM linalool for 10 min in a 60 mm tissue culture dish (VWR International, Radnor, PA). Each animal was pinched using a pair of Dumont No ...
-
bioRxiv - Plant Biology 2021Quote: ... Membrane protein samples containing 1 μg total Chl were solubilized and separated by electrophoresis on a 10 % SDS-polyacrylamide gel using Next Gel solutions and buffers (VWR, Radnor, PA, USA). Proteins were transferred to Immobilon-P PVDF membranes (MilliporeSigma ...
-
bioRxiv - Neuroscience 2021Quote: ... Seed protofibrils were then prepared by sonicating the above incubated fibrils for 10 minutes using a 550T Ultrasonic Cleaner (VWR International, Radnor, PA). Note that the mature fibrils prepared by 23-day incubation were not processed ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were then incubated with 250 nM TG or 10 µM monensin in fresh medium for 0.5 h at 37°C before 40 µM D-biotin (VWR Life Science, Radnor, PA) was added ...
-
bioRxiv - Cell Biology 2020Quote: ... The cultivation media used for each cell line was recommended by the supplier with an addition of 10% Fetal Bovine Serum (FBS, VWR, Radnor, PA, USA). For immunostaining ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10% (HeLa) or 15% (Tig-1) fetal bovine serum (HyClone, GE Healthcare Life Sciences, Marlborough, MA; Avantor Seradigm, VWR, Radnor, PA), 100 units/mL penicillin and 100 µg/mL streptomycin (Gibco ...
-
bioRxiv - Biophysics 2022Quote: Before MS analysis, peptides were resuspended in loading buffer (2% ACN, 0.1% FA) and completely solubilized in a bath sonicator (VWR, 35 kHz, 10 min).
-
bioRxiv - Immunology 2024Quote: ... at a concentration of 1x105 neurons/ml so that 1x105 neurons were seeded onto poly-D-lysine (10 µg/mL) coated acid-etched coverslips (VWR,, cat#MSPP-P06G1520F) and cultured at 37°C plus 5% CO2 ...
-
bioRxiv - Neuroscience 2024Quote: ... 12 µg of plasmid DNA (ratio 1:10 for guide-RNA and dCas9-construct containing plasmids) was diluted into 5 µl of sterile 10 % glucose and added to diluted In vivo-jetPEI® reagent (#101000040 VWR, Polyplus-transfection). The solution was mixed by pipetting and incubated at RT for 15 min ...
-
bioRxiv - Neuroscience 2023Quote: Monolayer cultures grown on Geltrex™ or laminin-coated #1.5 glass coverslips were fixed in 10% buffered formalin (Cat# CA71007-344, VWR, Radnor, PA, USA) for 10 minutes at room temperature and permeabilized with PBS-T (Ca2+/Mg2+-free PBS + 0.1% TWEEN® 20 (Cat# BP337-500 ...
-
bioRxiv - Microbiology 2023Quote: ... We prepared a 1:10 dilution with approximately 1 g of fecal sample that was measured with a sterile plastic spoon (VWR International, Dietikon, Switzerland) and subsequently suspended in 9 mL of anaerobic dilution solution ...
-
bioRxiv - Physiology 2023Quote: ... fish were acclimatized for 4–5 days prior to the assay in a cylindrical assay chamber (325 mL glass dish, 10 cm × 5 cm, VWR, Radnor, PA, USA) filled with conditioned water (pH 6.8–7.0 ...
-
bioRxiv - Bioengineering 2023Quote: ... in PBS at pH 10 at room temperature on an orbital shaker set at 150 rpm (no. 57018-754VWR; VWR International, Brisbane, CA). After 48 h ...
-
bioRxiv - Microbiology 2023Quote: ... and the cells were resuspended in 5 mL of methanol/dichlormethane/ethylacetate 10:2:3 (dichlormethane: SupraSolv, VWR Chemicals, Dresden, Germany; ethylacetate, HiPerSolv Chromanorm, VWR Chemicals, Dresden, Germany). The suspensions were sonicated (5 min ...
-
bioRxiv - Genetics 2024Quote: ... Chondrocytes were given 4 days of recovery from digestion and maintained in cell culture medium consisting of DMEM/F12 supplemented with 10% FBS (VWR Seradigm; #97068-085) before experiments ...
-
bioRxiv - Cancer Biology 2020Quote: Primary OSE cultures and the OSN2 cell line (Flesken-Nikitin et al. 2003) were maintained in culture in media containing DMEM (VWR; Cat#: 10-017-CM), Hams F12 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... was mixed with deuterium oxide (450 µl) containing sodium formate (1 µmol/L) and then passed through a 10 KDa cutoff centrifugal filter (VWR, Radnor, PA, United States). 1H-NMR spectra were acquired using a 600 MHz spectrometer (Bruker AVANCE II ...
-
bioRxiv - Immunology 2022Quote: ... gentamycin (10 μg/ml for plasmid maintenance in E. coli; 100 μg/ml for plasmid maintenance in P. aeruginosa, VWR, Cat. No. 97062-974).
-
bioRxiv - Neuroscience 2024Quote: ... Microscope slides with serially sectioned nerves were rinsed in 1× PBS for 5 min (repeated twice) and air-dried by incubation at 70°C for 10 min in an oven (VWR Scientific, Model 1525 incubator). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... and stored at −20 °C in an anti-freeze solution (30 % glycerol [Merck Millipore, Germany], 30 % ethylene glycol [VWR International, USA] and 10 % TBS) until further processing ...
-
bioRxiv - Neuroscience 2023Quote: ... Elma Schmidbauer GmbH), mixed (10 min, 2035 rpm, HeidolphTM MultiReax) and centrifuged (1 min, 12300 RCF, Micro-Star 12, VWR®, Radnor, PA, USA). The total protein concentration in each sample was determined using the BCA assay in 10-20 μl sample aliquots ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Viable embryos at the 2-cell stage (0.75 hours post fertilization (hpf)) were sorted into 4 replicates of 10 embryos within 24-well plates (VWR international, LLC Radnor, PA, USA). Replicates were exposed to 1 mL of vehicle (0.1% DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bacteria were lysed using lysis buffer (25 mM Tris-HCl [Sigma-Aldrich], 1 M NaCl [Sigma-Aldrich], 10 µM EDTA [Sigma-Aldrich], 1 mM DTT [VWR Chemicals]) supplemented with protease inhibitor [cOmplete ...
-
bioRxiv - Microbiology 2024Quote: ... Four sets of dilutions (100 to 10-3) of the filtered lysates were created in standard 96 well plates (VWR, cat. no. 25381-056), then arrayed in quadrants of a single 384-well plate ...
-
bioRxiv - Microbiology 2024Quote: Fresh bacterial cultures were inoculated with the wastewater sample at a 1:10 ratio in a 96 deep well plate (VWR, cat. no. 10755-250). Any surface biofilms present following incubation were disrupted via agitation of the culture with plastic pipette tips ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris® RNA FISH Wash Buffer B was removed and samples were resuspended in Vectashield Antifade Mounting Medium with DAPI (VWR; Cat #: H-1200-10). Samples were then placed on a slide and sealed with a coverslip and nail polish.
-
bioRxiv - Microbiology 2019Quote: ... Diluted cells were plated onto fresh LB plates (15 ml medium per plate, the diameter of the plate is 10 cm and the height 15 mm, VWR, US, Catalog number 25384-342), and multiple dilutions were used ...
-
bioRxiv - Cell Biology 2021Quote: ... in the transfer buffer (25 mM Tris base [Acros Organics 42457-1000], 192 mM glycine [Sigma-Aldrich G8898], and 10% v/v methanol [VWR BDH1135] in water) at 18 V for 50-70 min at room temperature using the Mini Gel system (Invitrogen NW2000) ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing 10% fetal bovine serum (X&Y Cell Culture, Cat# FBS-500, Lot# 7B0302) and 100 U/mL penicillin/streptomycin (VWR Life Sciences, Cat# 82026-730). For IFNγ (R&D Systems ...
-
bioRxiv - Biochemistry 2020Quote: α-syn seeds were generated by sonication of α-syn aggregates at different aggregation time points for 10 minutes in a water bath sonicator (VWR® Symphony™ Ultrasonic Cleaner). 5% (m/m ...
-
bioRxiv - Biophysics 2020Quote: ... Confocal Microscopy—HeLa cells grown in 35 mm imaging dishes (made in-house from Corning 35 x 10 mm dishes with VWR 18 x 18 mm #1.5 cover slips) were imaged 48 hours post transfection to maintain consistency with the FACS measurements ...
-
bioRxiv - Biophysics 2020Quote: ... U2OS cells were grown in 35 mm imaging dishes (made in-house from Corning 35 x 10 mm dishes with VWR 18 x 18 mm #1.5 cover slips). All CyTERM constructs were transiently transfected for 18–24 hours using Lipofectamine 3000 (Invitrogen ...